Labshake search
Citations for Addgene :
601 - 650 of 2249 citations for Dengue Virus NS1 Protein Serotypes 1 4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Membrane scaffold protein 1D1 (MSP1D1) was expressed from the pMSP1D1 plasmid (AddGene) with an N-terminal His-tag and was purified by affinity chromatography (26).
-
bioRxiv - Biochemistry 2021Quote: ... The plasmid encoding for membrane scaffold protein MSP1D1 was purchased from AddGene.43
-
bioRxiv - Genomics 2020Quote: Tn5 was generated by the MDC Protein Production & Characterization Platform from Addgene plasmid #60240 according to76 at 1.95 mg/ml with the following minor modifications ...
-
bioRxiv - Molecular Biology 2020Quote: Protein expression constructs were obtained through the following: FLAG-N1ICD (AddGene #20183), N2ICD (#20184) ...
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... For LRP6 and ADAMTSL2 protein interaction studies the LRP6-pCS2 (Addgene, 27242) was used for co-transfection ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077; http://n2t.net/addgene:27077;RRID:Addgene_27077) [pCXLE-hUL ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Cell Biology 2020Quote: HA-NFAT1(4-460)-GFP was a gift from Anjana Rao (Addgene plasmid # 11107). Patterned cells expressing NFAT-GFP was imaged using Zeiss LSM 880 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Plant Biology 2019Quote: ... Green fluorescent protein (GFP) from the Gateway entry vector pENTR4-GFP-C1 (Addgene) was transferred to pYES-DEST52 and pAG426GAL-ccdb using Gateway LR Clonase ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat (DR ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat (DR ...
-
bioRxiv - Molecular Biology 2019Quote: ... The nanodisc scaffold protein MSP1D1 was expressed and purified using pMSP1D1 (Addgene #20061) as described previously (Denisov et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Retrograde adeno associated viruses encoding green fluorescent protein (Addgene, Catalog number 50465-AAVrg) or tdtomato (Addgene ...
-
bioRxiv - Physiology 2021Quote: ... Fluorescent protein sequences were PCR-derived from pmVenus(L68V)-mTurquiose2 (Addgene plasmid #60493), Gamillus/pcDNA3 (Addgene plasmid #124837) ...
-
bioRxiv - Cell Biology 2020Quote: ... SpCas9 protein generated from the expression plasmid pET-NLS-Cas9-6xHis (Addgene #62934) was purified according to (Zuris et al. ...
-
bioRxiv - Developmental Biology 2021Quote: DR274 gRNA plasmids and Cas 9 protein were from Addgene (Cambridge Massachussets, USA) and New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid expressing anti-CRISPR protein (pEJS581; pCSDest2-AcrIIC4Hpa-FLAG-NLS; Addgene # 113436) was included in the triple-transfection packaging process to maintain intact rAAV:HDR:cleaved plasmids during production ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Brunello library targeting all human protein-coding genes28 was purchased from Addgene (#73179). Quality of the MYC-CRISPR and Brunello libraries was verified by next-generation sequencing on Illumina platform (BGI ...
-
bioRxiv - Systems Biology 2023Quote: ... and to amplify the fluorescent proteins from plasmids (SYFP2 from pSYFP2-C1 Addgene #22878 ...
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNAs were subcloned into the pMSCV-IRES-green fluorescence protein vector (Addgene #20672) with reference to a report by Masubuchi et al.43 The constructed plasmid was validated by sequencing prior to use.
-
bioRxiv - Cancer Biology 2024Quote: Pre-Intact clone was infected with pLV-Azurite (blue fluorescent protein, Addgene, 36086) and Pre-ARSIR1 clone was infected with SGEP-Renilla-713 (GFP ...
-
bioRxiv - Genomics 2024Quote: ... the expression plasmids (pRha-ABE8e-NRCH, Addgene #165417; and pABE8e-protein, Addgene #161788) were transformed into BL21Start DE3 competent cells (Thermo) ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fibroblasts were reprogrammed by electroporation delivery of episomal vectors pCXLE-hOCT3/4-shp53-F (Addgene, 27077), pCXLE-hSK (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen-inducible Rosa26::CreERT2 embryo and immortalized by transduction of pMXs-hc-MYC (Addgene 17220) followed by limiting dilution and clone derivation (see “iMEF B” in ref ...
-
bioRxiv - Neuroscience 2023Quote: ... oligonucleotide pairs (Extended Data Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Synthetic Biology 2023Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ; http://n2t.net/addgene:140957 ; RRID:Addgene_140957)
-
bioRxiv - Neuroscience 2023Quote: ... Mice were injected at 4 weeks of age with pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene viral prep # 105551-AAV9) in the right hemisphere to silence Tsc1 gene and pENN.AAV9.CamKII0.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the following lentiviral vectors were used at an MOI of 4 (96h): pWPXL-SOX4 (Addgene 36984), HA-tagged SOX4 [43] or empty vector control (Addgene 12257) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Cancer Biology 2021Quote: ... For expression of the Cas9 protein the lentiCas9-Blast expression vector was used (Addgene plasmid #59262 ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...