Labshake search
Citations for Addgene :
601 - 650 of 1757 citations for 7 CHLOROTHIENO 3 2 B PYRIDINE 6 CARBOXAMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
-
bioRxiv - Neuroscience 2020Quote: For retrograde tracing followed by STARmap (Fig. 6A, B) we injected 150 nL of AAVretro-Ef1a-FlpO (Salk vector core, Addgene #55637) or AAVretro-Ef1a-Cre (Salk vector core ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Molecular Biology 2019Quote: ... ΔPPXY)-T2A-GFP were generated by PCR from pCDNA4/TO-HA-NLS-SV40-B-MYB (this work) and pSpCas9n(BB)-2A-GFP (PX461) (Addgene #48140). All entry vectors were subcloned into pENTR3C (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and Lig4-/- abl pre-B cells and MCF10A human mammary epithelial cells used in this study all contain pCW-Cas9 (Addgene# 50661), which has a FLAG-tagged Cas9 cDNA under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Microbiology 2021Quote: A 2933 bp in vitro DNA synthesized IRES-vpr mKO fragment was ordered from Genewiz (South Plainfield, NJ) using an IRES sequence from pTRIPZ-hDDX5/7 (Addgene Plasmid #71307) (64 ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Neuroscience 2022Quote: ... Following AAVs were used: AAVrg-CAG-FLEX-rc[Jaws-KGC-GFP-ER2] (titer >7×1012 vg/ml, viral prep #84445-AAVrg, Addgene, US,34) or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml ...
-
bioRxiv - Cell Biology 2021Quote: HEK-293T cells plated on polylysine-coated coverslips were transfected with cDNA (100 ng/40000 cells) coding for mitochondrial-targeted mCherry (mCherry-Mito-7, a gift from Michael Davidson (Addgene plasmid # 55102), (Olenych et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR-mediated gene disruption was performed by identifying individual gRNA sequences with consistent enrichment in LDLlow cells in our previously reported CRISPR screens [7] and cloning these sequences into the BsmBI sites of pLentiCRISPRv2 (Addgene #52961, [43]) or into the BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Molecular Biology 2023Quote: Firefly and Renilla luciferase expression plasmids were cloned by standard methods starting with the pGL3 PUb-luc plasmid described previously (7) and pSLfa-PUb-MCS (Addgene plasmid # 52908). Transgenesis plasmids were generated using NEBuilder HiFi Assembly Master Mix (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: Sufu KO #2 was transfected with 2 μg of either 1436 pcDNA3 Flag HA (Addgene plasmid: 10792), a pcDNA Flag HA vector with the Sufu open reading frame cloned from pcDNA Su(fu ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Bioengineering 2019Quote: ... Neurons were dissociated and seeded on 4 different MEAs at ~3000 cells/mm2 over the electrode area and cultured in NbActiv1™ medium for at least 7-14 days prior to transfection with Fubi-ChR2-GFP (Addgene plasmid # 22051) or 21 days prior to transfection with C1V1tt (Addgene plasmid # 35497) ...
-
bioRxiv - Neuroscience 2024Quote: ... and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene, titer: ∼7×1012) into the NAcore ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Biochemistry 2020Quote: pHA#851: osm-10p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139208)
-
bioRxiv - Biochemistry 2020Quote: pHA#853: mec-4p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139210)
-
bioRxiv - Biochemistry 2020Quote: pHA#850: osm-10p∷FynY531F∷unc-54 3’UTR (Addgene ID: 139207)
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...