Labshake search
Citations for Addgene :
551 - 600 of 725 citations for Recombinant Human MBL2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The Jun-Nt VFP (Jun) and Fos-Ct VFP (Fos) and the human ACE2 and TMPRSS2 expressing plasmids were obtained from Addgene (#22012 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2022Quote: Full length human TAOK1 was obtained from Transomics Technologies in PCR-XL-Topo plasmid and inserted into sfGFP-C1 (Plasmid #54579, Addgene), using the EcoRI and MfeI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... RAD52KO and RAD52WT cells were transduced at a low multiplicity of infection (MOI<0.3) using the BFP-tagged Human Improved Genome-wide Knockout CRIPSR Library (Addgene #67989) (Tzelepis et al ...
-
bioRxiv - Neuroscience 2023Quote: ... The the AAV carrying the plasmid coding for iGluSnFR under the human synapsin promoter (pAAV.hSyn.iGluSnFR.WPRE.SV40) was a generous gift from Laren Looger (Addgene viral prep # 98929-AAV9) or produced in our own laboratory ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentiviruses with this construct were produced by transfecting human embryonic kidney 293T (HEK 293T) cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: Two-cell-stage embryos were bilaterally injected with 400 pg human EEA1 tagged to GFP (GFP-EEA1 wt was a gift from Silvia Corvera; Addgene plasmid # 42307 ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Cell Biology 2023Quote: ... pAP1σ1-RFP (for expression of fluorescently-tagged APα1 in human cells) was cloned by Gibson assembly using sequences derived from pAP1α1-eGFP (Addgene plasmid 53611) and pTagRFP-RAB2A (provided by S ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Biochemistry 2023Quote: ... human EZH2 wildtype and the K20R or S21A mutant of human EZH2 were cloned into the retroviral pMSCV-Puro vector containing 3xFlag-3xHA epitope (Addgene) and the recombinant retroviruses were packaged in 293 cells (Guo et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... CAFs were immortalized with stable expression of human telomerase reverse transcriptase (pBABE-neo-hTERT was a gift from Bob Weinberg (Addgene plasmid # 1774 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TGTCAGGGGACAGCAGGGGA and AGCAGAGGGTGCGGTGGAAA of the human GHRHR gene (ENSG00000106128) were cloned into the lenti-sgRNA (MS2) puro backbone vector (73795, Addgene). Lentiviral particles were generated by transient co-transfection with the pMD2.G (12259 ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Biophysics 2023Quote: ... 3C protease site cloned into a pcDNA3 vector containing human IgG Fc derived from pcDNA3-Nrxn1beta AS4(-)-Fc (a gift from Peter Scheiffele & Tito Serafini, Addgene plasmid # 59313 ...
-
bioRxiv - Immunology 2023Quote: ... MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Microbiology 2022Quote: ... sequences targeting human SFPQ were designed using the CRISPOR tool (http://crispor.tefor.net) and cloned into pX459-V2 vector (Addgene Plasmid #62988). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Human foreskin fibroblasts (HFF, SCRC- 1041, ATCC) were immortalized using a human telomerase-expressing retrovirus (pWZL-Blast- Flag-HA-hTERT, 22396, Addgene).
-
bioRxiv - Genetics 2023Quote: Two sgRNA oligonucleotide probes targeting different sites in human PIF1 and RAD52 or non-target were cloned into lentiCRISPRv2 puro (Addgene). Plasmids that contain each sgRNA were transfected to HEK293T cells using Lenti-X packaging single shots (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible inhibitory designer receptor human M4 muscarinic receptor (hM4DGi; AAV2-Syn-DIO-hM4Di-mCherry; Addgene) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: Cortical expression of the calcium sensor GCaMP7c was attained via focal viral injection of AAV1 under the human synapsin (hsyn) promoter for broad neuronal expression (#105321, Addgene).41 CD-1 male mice (P42-56 ...
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Microbiology 2023Quote: Human and cat ACE2 expressing lentiviral plasmids (pscALPS-hACE2 and pscALPS-cACE2) were obtained from Addgene (158081 and 158082, respectively). Each gene was tagged with a c-terminal Myc-tag epitope to facilitate detection ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Neuroscience 2023Quote: ... The Scrib-Flag plasmid was generated by amplifying human Scrib coding sequence from MSCV Puro SCRIB WT (Addgene, Cat# 88886) and fused with 3xFlag tag at the C-terminal in pcDNA3 backbone ...
-
bioRxiv - Immunology 2023Quote: ... PH5CH and Huh7-Lunet-TLR3 cells stably expressing the tBID death reporter and Cas9 were transduced with lentiviral vectors containing the GeCKOv2.0 human genome-wide sgRNA library (Addgene, USA) at MOI=0.3 ...
-
bioRxiv - Cell Biology 2023Quote: A plasmid for expression of full-length human KIF1C (pKIF1C-GFP) was a gift from Anne Straube (Addgene plasmid #130977107). All truncated versions of KIF1C (see Resource Table) ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genetics 2024Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid YFP-SRI was generated by sub-cloning human sorcin cDNA taken from pAd-hSRI (22) into KpnI-ApaI sites of mVenusC1 (Addgene #27794).
-
bioRxiv - Molecular Biology 2020Quote: FLAG-mEm-WT Tau and FLAG-mEm-Tau K174Q sequences were cloned into pAAV2 vector under human synapsin promoter (Addgene, #50465). Adenoviral particles were used to infect a primary hippocampal culture.
-
bioRxiv - Molecular Biology 2021Quote: ... similar to how we previously generated the human cell expression constructs for AcrIIA4 and AcrIIA5 (Addgene IDs 133801 and 133802, respectively) (see Supplementary Sequences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Genetics 2019Quote: sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2: GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA was cloned into the p3xFLAG CMV26 (C-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... was cloned into a rAAV vector under the human synapsin promoter using the plasmid pAAV-hSyn-EGFP (gift from Bryan Roth; Addgene, #50465) as backbone and removing EGFP ...
-
bioRxiv - Neuroscience 2020Quote: UAS-SMARCA1 construct: Flies carrying UAS-SMARCA1WT were generated using human SMARCA1 cloned into the pFastBac Dual vector (Addgene plasmid #102243). Gateway cloning (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene; plasmid #30116). All constructs were confirmed by sequencing.
-
bioRxiv - Microbiology 2020Quote: ... Vesicular stomatitis virus G protein (VSV-G) pseudotyped lentiviruses expressing human ACE2 were produced by transient co-transfection of pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... with a pEGFP-C1 mammalian vector containing full length human A53T variant αSyn with a fusion EGFP tag (Addgene, Plasmid #40823), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...