Labshake search
Citations for Addgene :
551 - 600 of 1444 citations for Recombinant Human LDLR protein GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... amplifying the human fragment from GLP1R-tango (plasmid from Addgene, #66295, RRID:Addgene_66295), including the leader sequence present in the GLP1R-tango ...
-
bioRxiv - Neuroscience 2024Quote: ... amplifying the human fragment from GLP1R-tango (plasmid from Addgene, #66295, RRID:Addgene_66295), including the leader sequence present in the GLP1R-tango ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human TG2 was amplified from plasmid W118-1_hTGM2-Flag [bought from Addgene, catalog number #180407] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human LOXL2 was amplified from plasmid pQXCINeo-LOXL2-BC [bought from Addgene, catalog number #134763] ...
-
bioRxiv - Biophysics 2024Quote: ... The human UBA1 and UBA7 genes were obtained from Addgene (34965, 12438). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... we inserted human LC3/GBRP cDNA in a pGEX-4T1 vector (RRID:Addgene_223726 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Cell Biology 2024Quote: ... The fluorescent protein in K-GECO1 (Addgene plasmid #105864 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fusion protein DeAct-SpvB-EGFP (Addgene #89446) was subcloned to pCS2 (isolated from pCS2-3nls-EGFP plasmid ...
-
bioRxiv - Neuroscience 2021Quote: For Ca2+ indicator expression at M1, recombinant AAV vectors (rAAVs, serotype 1) encoding jRGECO1a under the control of the synapsin promoter (Addgene #100854-AAV1) was stereotaxically delivered as follows ...
-
bioRxiv - Neuroscience 2024Quote: Cre-dependent recombinant adeno-associated virus (rAAV) for GCaMP7f (rAAV1-syn-FLEX-jGCaMP7f-WPRE, Addgene #1944820-AAV1, titer: ≥1:1013 vg/mL) were used to express GCaMP7f in the hippocampus of Vgat-Cre mice ...
-
bioRxiv - Cancer Biology 2024Quote: The protein A–Tn5 fusion protein (pA–Tn5) was produced using the 3XFlag-pA-Tn5-Fl plasmid (Addgene, 124601) in a bacterial expression system and Cut&Tag was performed as previously described(36) ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...
-
bioRxiv - Cancer Biology 2022Quote: ... The designed sgRNAs were cloned into human lentiCRISPR v2 vector (Addgene, MA, USA). For lentiviral packaging ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T target cells transfected with 500ng of a human ACE2 expression plasmid (Addgene) were seeded at 2×104 in 100μL DMEM-10% in a white-bottomed 96-well plate (Corning ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MCU-GFP plasmid was a gift from Vamsi Mootha (Addgene plasmid # 31732).
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...