Labshake search
Citations for Addgene :
551 - 600 of 1256 citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.
-
bioRxiv - Molecular Biology 2019Quote: ... wildtype or BRCA2-knockout HeLa cells were transduced with the Brunello Human CRISPR knockout pooled library (Addgene, 73179).10 To achieve a representation of 250 cells per sgRNA ...
-
bioRxiv - Genetics 2021Quote: ... and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498)) or the catalytic domain (CD ...
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral particles were produced in the Human Embryonic Kidney 293T (HEK293T) cell line with the psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full-length wild-type cDNA of human BRCA2 was subcloned from pcDNA3 236HSC WT (Addgene plasmid # 16246) into the piggyBac vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... Briefly three different sgRNAs targeting human SAMHD1 were designed and cloned into lentiCRISPR v2 vector (Addgene plasmid # 52961). Packaging 293T cells were transfected with SAMHD1 sgRNAs (CRISPR SAMHD1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207; http://n2t.net/addgene:22207; RRID:Addgene_22207).
-
bioRxiv - Microbiology 2021Quote: ... Flag-tagged full-length Human gamma-catenin construct in the pcDNA3 vector was obtained from Addgene (plasmid #16827).
-
bioRxiv - Microbiology 2021Quote: The human genome-wide Brunello Library (Doench et al., 2016) in lentiCRISPRv2 was obtained from Addgene (cat# 73179) and amplified according to depositor’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene). Full-length EGFP fused N-terminally to a nuclear localization signal (NLS ...
-
bioRxiv - Microbiology 2020Quote: ... Human CRISPRi pooled library (Dolcetto) was a gift from John Doench (Broad Institute, also available on Addgene #92385). For the secondary screens ...
-
bioRxiv - Cancer Biology 2020Quote: ... the optimized sgRNA lentiviral expression vector (LRG2.1T) and the lentiviral human codon-optimized Streptococcus pyogenes Cas9 vector (LentiV_Cas9_Puro, Addgene: 108100) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... pBabe-puro plasmids containing human C/EBPB LAP2 and LIP isoforms were from Addgene (Cat.# 15712 and 15713).
-
bioRxiv - Cancer Biology 2022Quote: ... human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cat. No. 44719). Two chimeric guide RNA expression cassettes containing two of the following sgRNAs (sgRNA1 ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid expressing FLAG-tagged wild-type human HDAC1 was a gift from Eric Verdin (Addgene Plasmid # 13820). HCT116 cells were transfected in 10 cm plates with 8 μg plasmid and 40 μl PEI ...
-
bioRxiv - Biophysics 2022Quote: ... pET15b CnA CnB, which contains human PPP3CA and PPP3R1 (Mondragon et al., 1997) was obtained from Addgene (11787). Plasmid pQE30 CaM containing rat Calmodulin (protein sequence 100% identical to human ...
-
bioRxiv - Molecular Biology 2019Quote: ... Complemention of timeless was achieved by transfection of plasmids encoding the human Timeless WT cDNA (Addgene plasmid 22887), or truncated versions thereof ...
-
bioRxiv - Neuroscience 2022Quote: ... Mammalian cells were transfected with either the empty vector (pAAV) or human WT aSyn pAAV vector (Addgene plasmid # 36055; http://n2t.net/addgene:36055 ; RRID:Addgene_36055).
-
bioRxiv - Cancer Biology 2022Quote: ... Human SUZ12 cDNA was cloned into pLV-EF1α-IRES-Puro (gift from Tobias Meyer, Addgene Plasmid #85132, RRID:Addgene_85132). MAVS sgRNA was cloned into LRG2.1_Puro (gift from Christopher Vakoc ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human SUZ12 cDNA was cloned into pLV-EF1α-IRES-Puro (gift from Tobias Meyer, Addgene Plasmid #85132, RRID:Addgene_85132). MAVS sgRNA was cloned into LRG2.1_Puro (gift from Christopher Vakoc ...
-
Comparative performance of the BGI and Illumina sequencing technology for single-cell RNA-sequencingbioRxiv - Genomics 2019Quote: Comprised of cultured human trabecular meshwork cells (TMWCs) that had been transfected with a CROP-seq (Addgene: 99248) guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2020Quote: cDNAs for human prostate cancer TMPRSS2-ERG fusion was cloned into retroviral-based vector MSCV-C-HA (Addgene). Retrovirus was produced in 293T cells by standard methods using Ampho packaging vector ...
-
bioRxiv - Cancer Biology 2021Quote: U2OS cells harboring Doxycycline-inducible human RNF168 were generated using the pINDUCER20 lentiviral vector (Addgene plasmid # 44012; http://n2t.net/addgene:44012; RRID:Addgene_44012). All cell lines were cultured in DMEM medium supplemented with 10% fetal bovine serum and penicillin–streptomycin (1%) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.2 (a1Ha-pcDNA3 was a gift from Dr E. Perez-Reyes, Addgene #45809 (Cribbs et al. 1998), human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... The respective cell lines were subsequently transduced with the human genome-wide CRISPR-KO (GeCKO, Addgene, #1000000048, #1000000049) sgRNA library at a 1000-fold representation and a multiplicity of infection of <0.3 to ensure one sgRNA integration per cell ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of human CAV1 was PCR amplified from the mammalian expression plasmid Emerald-CAV1 C-10 (Addgene No ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Genetics 2020Quote: ... The expression plasmid for human Nucleolin was constructed by amplifying the NCL ORF from GFP-Nucleolin (Addgene; #28176) using primers NCL-For and NCL-1XHA Rev (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... human telomerase (hTERT) was exogenously expressed using pBABE-neo-hTERT (Addgene 1774, a gift from Bob Weinberg ((44)) ...
-
bioRxiv - Neuroscience 2022Quote: ... A135P and wildtype human iPSC-derived NGN2 neurons were transfected with 0.8 µg of Mito7-dsRed (Addgene #55838) and 0.2 µg of pCAG-Venus at day 5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... A2058-dCas9-KRAB cell lines were infected with Stress and Proteostasis-human subpooled sgRNA library (Cat#83973, Addgene), with MOI=0.3 and selected with puromycin (2 μg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... expressing 76,441 sgRNAs against 19,114 human genes + 1,000 non-targeting sgRNA controls in plentiCRISPRv2 was obtained from Addgene (51). The library was electroporated into Endura electrocompetent cells (# 60242 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Cell Biology 2022Quote: ... The human NALCN cDNA and the mCherry cDNAs were subcloned in the pLV-EF1a-IRES-Blast (Addgene #85133) using standard molecular biology techniques.
-
bioRxiv - Molecular Biology 2023Quote: The genome-wide human CRISPR/Cas9 Synergistic Activation Mediator (SAM) sgRNA library (gift from Feng Zhang, Addgene #1000000057) was amplified as recommended ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cell Biology 2023Quote: The human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) (49) ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074; http://n2t.net/addgene:24074; RRID:Addgene_24074). GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ; http://n2t.net/addgene:103938; RRID:Addgene_103938). Plasmids encoding tethered fusion constructs were custom cloned by Epoch Biosciences (Missouri City ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Immunology 2024Quote: ... U87 MG IL13Rα2+ RFP+ cells were generated by stable expression of human IL13Rα2 and RFP (Addgene plasmid #26001) and sorting for RFP and IL13Rα2 expression ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049; http://n2t.net/addgene:24049; RRID:Addgene_24049). This construct (hIR ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 7.5 ug of the Human Improved Whole-Genome Knockout CRISPR library V1 (by Kosuke Yuya, Addgene #67989), 18.5 ug of psPax2 ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...