Labshake search
Citations for Addgene :
551 - 600 of 1994 citations for Heme oxygenase 1 HO 1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... cDNA encoding human Dnm1 wild-type was amplified from Dnm1-pmCherryN1 (Addgene #27697 ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... pcDNA3-HA-human OCRL (gift from Pietro De Camilli, Addgene plasmid # 22207); pCDNA3.0_mitoLAMA-G97 (gift from Kai Johnsson ...
-
bioRxiv - Cell Biology 2019Quote: Human STAMBPL1 was PCR amplified from FLAG-HA-STAMBPL1 (Addgene plasmid #22559), human TBC1 domain containing kinase (TBCK ...
-
bioRxiv - Cancer Biology 2020Quote: The Brunello CRISPR library targeting the human genome was obtained from Addgene (via John Doench and David Root ...
-
bioRxiv - Systems Biology 2021Quote: The human Toronto knockout v3 (TKOv3) genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6 ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Biochemistry 2023Quote: ... Human codon optimized wild-type Mpro was obtained from Addgene (catalog #141370). Mpro single point mutants (M49A ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Molecular Biology 2021Quote: ... The p-EGFP plasmid (#6077-1) was purchased from Addgene (Watertown, MA); the pEGFP-TSC2 plasmid was created as previously described in (52 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV-mDlx-GFP-Fishell-1 (gift from Gordon Fishell; Addgene plasmid # 83900) was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... MKL-1 Cas9 cell line was developed using pCWCas9 Blast (Addgene #83481) with Blasticidin (10ug/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... HIV-1-GAG fused with EGFP was purchased from Addgene (plasmid 80605). Ezrin plasmid was a generous gift of Adam Kwiatkowski (University of Pittsburgh School of Medicine ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Peter Howley (42) ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Dr ...
-
bioRxiv - Biochemistry 2021Quote: ... TRCN0000047920) and cloned into the lentiviral pLKO.1 vector (Addgene, Watertown, MA) as previously described 56 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cell Biology 2021Quote: ... pLVX-GFP-Centrin-1 was a gift from Manuel Thery (Addgene #73331).
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-shmSlug4 was a gift from Bob Weinberg (Addgene plasmid # 40648), pPGS-hSLUG.fl.flag was a gift from Eric Fearon (Addgene plasmid # 25696) ...
-
bioRxiv - Cell Biology 2021Quote: ... pAAV-mDlx-GFP-Fishell-1 was kindly provided by Gordon Fishell (Addgene plasmid #83900 ...
-
bioRxiv - Cell Biology 2021Quote: ... but with a pLKO.1-based vector (gift from Elaine Fuchs, Addgene plasmid # 25999 ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... DLD-1 cells were infected with pCLX-CHOP-dGFP lentiviruses (Addgene, 71299), single cell isolated ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified TaPHB-1 was cloned into pcDNA3-RFP plasmid (#13032, Addgene) using HindIII and NotI restriction sites ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Biophysics 2022Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator and a copy of the mNeonGreen fluorescence protein ...
-
bioRxiv - Biophysics 2022Quote: ... pGEMHE:mTREK-1(K271Q) was a gift from Dan Minor (Addgene plasmid # 133270) (Lolicato et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Biochemistry 2021Quote: The FLAG-HSF-1 plasmid was purchased from Addgene (ID 32537, RRID:Addgene_32537), which was originally established by Dr Stuart Calderwood (40) ...
-
Serotonin Modulates an Inhibitory Input to the Central Amygdala from the Ventral Periaqueductal GraybioRxiv - Neuroscience 2022Quote: ... NC) or AAV9-hSyn-EGFP (diluted 1:10 in sterile PBS, Addgene) was injected bilaterally into the CeA of C57Bl/6J mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1-Puro was a gift from Bob Weinberg (Addgene plasmid # 8453) (35) ...
-
bioRxiv - Pathology 2020Quote: ... the pLKO.1-puro empty vector was purchased from Addgene (Watertown, MA). A scrambled shRNA control and shRNAs specific for the mouse EZH1 and EZH2 genes were designed by RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Cell Biology 2020Quote: ... or GFP-K17ΔNLS cDNA (pEGFP-C3 vector backbone; Addgene REF# 6082-1) were transfected into cells using FuGENE HD Transfection Reagent (Promega REF# E2311 ...