Labshake search
Citations for Addgene :
551 - 600 of 746 citations for GAS6 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The gRNAs targeting human AMPK α1 or α2 described previously were cloned into the gRNA/Cas9 expression vector pLenti-CRISPR v2 (Addgene) 91 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were immortalized by human telomerase gene (hTERT) using the retrovirus vector pLXSN-hTERT or the lentivirus vector pCLX-PGK-hTERT vector (#114315, Addgene). Retrovirus and lentivirus preparations ...
-
bioRxiv - Cancer Biology 2019Quote: ... The plasmid construct targeting exon 2 of human AIRE (AIREKO) was created using pSpCas9(BB)-2A-GFP (a gift from Dr. Feng Zhang, #48138, Addgene, http://n2t.net/addgene:48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380 ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-hRab31.dn3 (#1019) plasmids encoding GFP-labeled versions of the indicated human wild-type proteins were from Addgene (Cat# 49549 ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB was cloned into the UC Berkeley MacroLab 4B vector (gift from Scott Gradia, Addgene plasmid #30115). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in Sf9 insect cells using the Bac-to-Bac Baculovirus expression system (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Immunology 2020Quote: ... 1.5ugs of each hU6_sgRNAs and 3ugs a plasmid expressing human codon-optimised CAS9 driven by the CMV promotor (Addgene # 41815). 48 hours post transfection the media was changed for G418 selection media ...
-
bioRxiv - Microbiology 2021Quote: ... we cloned the human ACE2 cDNA sequence (NP_001358344.1) into a pLV-EF1a-IRES-Puro backbone vector (Addgene, cat no. 85132), and prepared lentiviral particles as described previously65 ...
-
bioRxiv - Genomics 2021Quote: Toronto human knockout pooled library (TKOv3) containing 71,090 based on a lentiCRISPRv2 backbone was a gift from Jason Moffat (Addgene #90294). The library was transformed and amplified using 25 μl Endura Competent Cells (Lucigen ...
-
bioRxiv - Genetics 2020Quote: Two pairs of gRNAs (Table S1 in “Supplementary file”) intermediated by human U6 (hU6) promoter were cloned after hU6 promoter of the plentiCRISPR_V2 plasmid (Addgene, #52961), according to Vidigal et al.’s protocol 34 ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal FLAG-tagged TMPRSS2 orthologues and the human ΔHDS mutant were ligated into the lentiviral pWPI-BLR vector (Addgene) via restriction digestion or using HiFi Builder (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a plasmid expressing human Ago2 fused to GFP in the N-terminal region of Ago2 was obtained from Addgene (11590). For recombinant protein purification ...
-
bioRxiv - Neuroscience 2022Quote: ... and fused in frame without a linker to human H2B (H2BC11) (accession #NM_021058) and cloned into the pAAV-CAG-tdTomato (Addgene #59462) using the sites KpnI and EcoRI at the 5 and 3 prime end respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV8 encoding the inhibitory designer receptor KORD fused to the fluorescent protein mCitrine under the control of the human synapsin promoter in a Cre-dependent manner was obtained from Addgene (AAV8-hSyn-dF-HA-KORD-IRES-mCitrine ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Microbiology 2022Quote: ... The Jun-Nt VFP (Jun) and Fos-Ct VFP (Fos) and the human ACE2 and TMPRSS2 expressing plasmids were obtained from Addgene (#22012 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2022Quote: Full length human TAOK1 was obtained from Transomics Technologies in PCR-XL-Topo plasmid and inserted into sfGFP-C1 (Plasmid #54579, Addgene), using the EcoRI and MfeI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... pAP1σ1-RFP (for expression of fluorescently-tagged APα1 in human cells) was cloned by Gibson assembly using sequences derived from pAP1α1-eGFP (Addgene plasmid 53611) and pTagRFP-RAB2A (provided by S ...
-
bioRxiv - Neuroscience 2023Quote: ... The the AAV carrying the plasmid coding for iGluSnFR under the human synapsin promoter (pAAV.hSyn.iGluSnFR.WPRE.SV40) was a generous gift from Laren Looger (Addgene viral prep # 98929-AAV9) or produced in our own laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Two-cell-stage embryos were bilaterally injected with 400 pg human EEA1 tagged to GFP (GFP-EEA1 wt was a gift from Silvia Corvera; Addgene plasmid # 42307 ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentiviruses with this construct were produced by transfecting human embryonic kidney 293T (HEK 293T) cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Biochemistry 2023Quote: ... human EZH2 wildtype and the K20R or S21A mutant of human EZH2 were cloned into the retroviral pMSCV-Puro vector containing 3xFlag-3xHA epitope (Addgene) and the recombinant retroviruses were packaged in 293 cells (Guo et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... CAFs were immortalized with stable expression of human telomerase reverse transcriptase (pBABE-neo-hTERT was a gift from Bob Weinberg (Addgene plasmid # 1774 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TGTCAGGGGACAGCAGGGGA and AGCAGAGGGTGCGGTGGAAA of the human GHRHR gene (ENSG00000106128) were cloned into the lenti-sgRNA (MS2) puro backbone vector (73795, Addgene). Lentiviral particles were generated by transient co-transfection with the pMD2.G (12259 ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Immunology 2023Quote: ... MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Microbiology 2022Quote: ... sequences targeting human SFPQ were designed using the CRISPOR tool (http://crispor.tefor.net) and cloned into pX459-V2 vector (Addgene Plasmid #62988). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Human foreskin fibroblasts (HFF, SCRC- 1041, ATCC) were immortalized using a human telomerase-expressing retrovirus (pWZL-Blast- Flag-HA-hTERT, 22396, Addgene).
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... RAD52KO and RAD52WT cells were transduced at a low multiplicity of infection (MOI<0.3) using the BFP-tagged Human Improved Genome-wide Knockout CRIPSR Library (Addgene #67989) (Tzelepis et al ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Genetics 2023Quote: Two sgRNA oligonucleotide probes targeting different sites in human PIF1 and RAD52 or non-target were cloned into lentiCRISPRv2 puro (Addgene). Plasmids that contain each sgRNA were transfected to HEK293T cells using Lenti-X packaging single shots (Takara ...
-
bioRxiv - Immunology 2023Quote: ... PH5CH and Huh7-Lunet-TLR3 cells stably expressing the tBID death reporter and Cas9 were transduced with lentiviral vectors containing the GeCKOv2.0 human genome-wide sgRNA library (Addgene, USA) at MOI=0.3 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible inhibitory designer receptor human M4 muscarinic receptor (hM4DGi; AAV2-Syn-DIO-hM4Di-mCherry; Addgene) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: Cortical expression of the calcium sensor GCaMP7c was attained via focal viral injection of AAV1 under the human synapsin (hsyn) promoter for broad neuronal expression (#105321, Addgene).41 CD-1 male mice (P42-56 ...