Labshake search
Citations for Addgene :
551 - 600 of 3074 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... These plasmids are based on all-in-one pSpCas9(BB)-2A-Puro (px459) (Addgene #62988) V2.0 and pSpCas9n(BB)-2A-Puro (px462 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using a similar all-in-one lentivirus that did not express GFP (pLIX-403; Addgene_41395), and were made monoclonal via single-cell sorting to ensure comparable inducible expression of UNK in cells within a population and among populations expressing Flag-HA-tagged UNKWT ...
-
bioRxiv - Biochemistry 2023Quote: ... we constructed a constitutive all-in-one dead SaCas9 (dSaCas9) system from construct (Addgene #164563) via Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 50 ng/µl Peft-3::Cas9 (Addgene 46168) and 2,5 ng/µl Pmyo-2::tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab). To generate Emerald-Rab7L8A ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Genetics 2019Quote: ... into the all-in-one lentivirus vector LentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2021Quote: Each pair of sgRNAs cloned into All-In-One (AIO) CRISPR/Cas9 nickase plasmids (#74119, Addgene) and sequences are shown in table 1 ...
-
bioRxiv - Cancer Biology 2022Quote: CD73 gene-editing was generated by electroporation of all-in-one CRISPR/Cas9 vector (px330, Addgene) expressing the 20mer target sequence GCAGCACGTTGGGTTCGGCG (exon1) ...
-
bioRxiv - Cell Biology 2023Quote: ... one of the gRNAs was cloned into SpCas9(BB)-2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the px330-mCherry plasmid (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were injected with one of the four viruses: rAAV1/EF1α1.1-FLPX-rc [Chronos-GFP] (Addgene plasmid #122102 ...
-
bioRxiv - Cell Biology 2019Quote: ... BbsI digested fragment containing gRNA core and dU6:3 promoter was PCR amplified from pCFD4-U6:1_U6:3-tandemgRNAs (gift from Simon Bullock (Addgene plasmid # 49411) (Port et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...