Labshake search
Citations for Addgene :
551 - 600 of 3412 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSynapsin1-hM3D(Gq)-mCherry (Addgene, #50474, ≥ 2 x 1012 vg/ml) or AAV9-hSynapsin1-Lamp1-mScarlet-I (3.06 x1012 vg/ml ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus (AAV) type 2 carrying cre-dependent ChR2-eYFP (Addgene plasmid 20298 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700; http://n2t.net/addgene: 180700; RRID:Addgene_180700) were gifts from David Nemazee (46 ...
-
bioRxiv - Cancer Biology 2023Quote: ... + pLenti-CMV-GFP-Neo (657-2) GFP expression vector (Addgene, Plasmid 17447). All cells were cultured with RPMI 1640 media ...
-
bioRxiv - Synthetic Biology 2023Quote: The promoters from the genes alcohol dehydrogenase 2 (ADH2, Addgene ID 195015), xylose reductase (XYL1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pRC/CMV::DVL-2-Myc was obtained from Addgene (Cambridge, Massachusetts, USA) (plasmid #42194 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 µg of the envelope plasmid (pMD2.G / VSVG, Addgene #12259) per well were co-transfected using PEI ...
-
bioRxiv - Developmental Biology 2024Quote: ... 293T cells were transfected with 2 μg of pMD2.G (Addgene, 12259), 4 μg of psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pDONR207 SARS-CoV-2 nsp1 Delta RC (M1, K164A/H165A, Addgene #164522) and pDONR207 SARS-CoV-2 nsp1 R124A/K125A (M2 ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... and 2 µg of the envelope plasmid (pMD2.G / VSVG, Addgene #12259) per well were co-transfected using PEI as described above ...
-
bioRxiv - Molecular Biology 2024Quote: Using the 3XFlag-pA-Tn5-Fl expression vector[2] (Addgene plasmid #124601), protein A sequence was replaced with an anti-GFP nanobody sequence that was PCR amplified from the pGEX6P1-GFP-Nanobody vector [30] (Addgene plasmid #61838 ...
-
bioRxiv - Genetics 2024Quote: ... was constructed by replacing the dU6:2 promoter from pLib6.4 (Addgene #133783) with the dU6:3 promoter from pCFD3 (Addgene #49410 ...
-
bioRxiv - Cancer Biology 2020Quote: EKVX cells (4×105) were plated in 6-well plates and were transfected with 3μg of linearized lentiCas9-Blast (Addgene, 52962) using lipofectamine 2000 (11-668-019 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells were transfected with 6 μg of pLenti6/V5-EXPR-Apaf1-mEGFP mixed with 4 μg of pCMVR8.74 (gift from Didier Trono, Addgene #22036) and 4 μg of pMD2.G (gift from Didier Trono ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9; http://n2t.net.addgene:20298; RRID; Addgene:20298, gift from Karl Deisseroth); Fig 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Pipettes were front-filled with AAV (serotype 2/1) expressing either CAG-FLEX-GFP (UPenn, lot# V0827) or pCAG-FLEX-tdTomato-WPRE (Addgene cat# 51503). 3 min after reaching the target ...
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Immunology 2024Quote: ... Trpv1-Cre mice were intraperitoneally injected on postnatal day 1 with 10uL of 2×1011 genome copies/mL AAV9-FLEX-tdTomato (Addgene, 8306-AAV9) then sacrificed for lung harvest at 6-8 weeks old ...
-
bioRxiv - Cancer Biology 2024Quote: ... and eGFP cDNA (without 1st ATG) were linked using 4 amino acid “DLEL” and subcloned into pLenti-CMV-EGFP-Blasticidin lentiviral vector (Addgene, 17445) backbone ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... pGEM4Z-T7-5’UTR-EGFP-3’UTR-A64 was a gift from Christopher Grigsby & Molly Stevens (Addgene plasmid # 203348 http://n2t.net/addgene:203348 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Bioengineering 2020Quote: ... and a kanamycin resistance (from the plasmid pBBR1MCS-2 (55) purchased from Addgene 85168) ...
-
bioRxiv - Genetics 2021Quote: ... daf-16 (#34833) and daf-2 RNAi (#34834) clones were obtained from Addgene. mbl-1 RNAi was cloned from C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259)) mixed in 0.45 mL water ...
-
bioRxiv - Cell Biology 2022Quote: ... pmTurquoise2-Golgi was a gift from Dorus Gadella (Addgene plasmid # 36 2 05)32 ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCas9-Blast (ULK2 sgRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... , (2) nlsLexA::GADfl ORF was amplified from pBPnlsLexA::GADflUw (Gerald Rubin54, Addgene-26232), and (3 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Pmyo-2::mCherry co-injection marker (2.5 ng/μl; pCFJ90, Addgene #19327) were micro-injected in the gonad of young adults ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCRISPRv.2-hygro (Addgene 98291) ...
-
bioRxiv - Cell Biology 2022Quote: ... Number of pulses: 2×106 cells were transfected with ING2-PHD_GFP (Addgene, #21589) or pCSDEST2_NLS-GFP (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT Δ(2-15)-3F pCW57.1 was generated using the pCW57.1 (Addgene, #41393) plasmid backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... 2×106 cells were transfected with 5ug pCBA-I-SceI plasmid (Addgene #26477), 40nmol siRNA and 1ug Cerulean-c1 plasmid (Addgene #54604 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and pLVX-EF1alpha-SARS-CoV-2-Nsp2-2XStrep-IRES-Puro plasmid (Addgene, 141368) were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ...
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259) mixed in 0.45 mL water ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 μg of VSV-G envelope expressing plasmid (pMD2.G, Addgene #12259), and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G ...
-
bioRxiv - Genomics 2023Quote: ... and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178). In this study we also used our Essential/Safe-havens library described above.
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150; http://n2t.net/addgene:49150; RRID:Addgene 49150) DNA was used to label the ER ...