Labshake search
Citations for Addgene :
551 - 600 of 2632 citations for 6 Hydroxy 2 oxo 2H 1 benzopyran 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Genomics 2019Quote: ... We co-transfected the pLentiRNACRISPR constructs together with a GFP expression plasmid in a 2:1 molar ratio. The guide RNA length comparison (Supplementary Fig. 1d) was done using previously published RfxCas13d constructs (Addgene 109049 and 109053), except that we removed the GFP cassette from the RfxCas13d plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Biophysics 2021Quote: ... we used the retinoic acid-responsive firefly luciferase expression vector pGL3-RARE-luciferase (Addgene plasmid #13458; http://n2t.net/ad-dgene:13458; RRID:Addgene_13458), a gift from T ...
-
bioRxiv - Physiology 2019Quote: HepG2 cells were transfected with the luciferase expression construct under the Fatty Acid Synthetase (FAS) Promoter (Addgene# 8890) along with β-Gal plasmid (Ambion Cat ...
-
bioRxiv - Immunology 2022Quote: ... The Vκ1-33/CBE replacement of Vκ3-2 was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and two guide RNAs that target the mouse Vκ3-2 segment ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Genomics 2019Quote: The plasmid pCMV-myc-Atg7(2) expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1 ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti-X2-Zeo-DEST (749-3) [a gift from Eric Campeau (Addgene, 21562)] and the donor vector ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA 3-CDK9 HA plasmid was purchased from Addgene (ID 14640, RRID:Addgene_14640), which was originally established by Dr Matija Peterlin (43) ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Genetics 2023Quote: ... and a poly-A p-3’entry clone (Addgene, Kristen Kwan, Chien lab) were used.
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... and the p10-3’UTR PCR amplified from the plasmid pJFRC81 (Addgene #36432). These were then cloned by Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected with RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Neuroscience 2024Quote: ... 750 nl of the retroAAV-hsyn-Cre (500nL, Addgene Lot v70508, 3*1013) was injected in the VTA of male and female C57/BL6 mice ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2019Quote: Plasmids pNH13 (pmyo-2::QuasAr::mOrange) and pNH12 (pmyo-2::MacQ::mCitrine) were generated by subcloning of plasmids #59173 and #48762 (Addgene) into pPD132.102 (pmyo-2 ...