Labshake search
Citations for Addgene :
551 - 600 of 2442 citations for 1R 2R 1 2 Bis 2 bromophenyl N1 N2 dimethylethane 1 2 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2024Quote: ... LBR pEGFP-N2 (646) (Addgene #61996); pFKBP-GFP-C1 (Clarke and Royle ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... mEos4b-N1 was a gift from Micheal Davidson (Addgene # 54814 ...
-
bioRxiv - Cell Biology 2021Quote: ... pScarlet-N1 was a gift from Oskar Laur (Addgene plasmid # 128060 ...
-
bioRxiv - Neuroscience 2022Quote: ... AcGFP1-N1 was a gift from Michael Davidson (Addgene plasmid # 54705 ...
-
bioRxiv - Neuroscience 2021Quote: ... pmRuby2-N1 plasmid was obtained from Addgene (accession # U55762). Single-stranded TATA box and DRE oligonucleotides were synthesized using Integrated DNA Technologies custom DNA service ...
-
bioRxiv - Cancer Biology 2021Quote: mEGFP-N1 was a gift from Michael Davidson (Addgene plasmid # 54767 ...
-
bioRxiv - Biophysics 2020Quote: ... The pLifeAct-mScarlet-N1 plasmid was obtained from Addgene (#85054 ...
-
bioRxiv - Microbiology 2021Quote: ... parahaemolyticus RIMD 2210633 genomic DNA and sfGFP-N1 (Addgene), respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... and mVenus-N1 (color variant of Addgene plasmid #54843) for an untagged version.
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6x1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Molecular Biology 2024Quote: ... nsp1 coding sequences were amplified by PCR from pDONR207 SARS-CoV-2 nsp1 (WT, Addgene #141255), pDONR207 SARS-CoV-2 nsp1 Delta RC (M1 ...
-
bioRxiv - Microbiology 2024Quote: ... iBMDM cell suspensions were mixed with 2 µg of pEGFP VAMP2 (mouse; Addgene plasmid # 42308 (51). Cells were electroporated using the program FF-100 and immediately transferred to pre-warmed DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received bilateral 2 uL viral injections of rAAV5 pZac2.1-GfaABC1D-Rpl22-HA (Addgene cat #111811) into the nucleus accumbens (6° angle ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pcDNA3-SARS-CoV-2-S-RBD-sfGFP was a gift from Erik Procko (Addgene plasmid #141184), and a his-tag was added to the C-terminus of the RBD-sfGFP open reading frame (ORF) ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163; http://n2t.net/addgene:190163; RRID:Addgene_190163)(1) ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNAs of miRFP670 and miRFP703 were obtained from pmiRFP670-N1 and pmiRFP703-N1 (gifts from Vladislav Verkusha, Addgene plasmids #79987 and #79988), and subcloned to obtain pMNATZA1-miRFP670 and pMNATZA1-miRFP703 ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Cell Biology 2021Quote: ... pET-Ran(Q69L) and AcGFP1-N1 were obtained from (Addgene). Dendra2-RUVBL2 was constructed by in-frame insertion of Dendra2 into the N-terminus of RUVBL2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Transient transfection was performed with pEGFP-n1-APP (69924, Addgene) using the jetOPTIMUS transfection reagent (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... pEYFP-N1-Pink1 was a gift from Richard Youle (Addgene plasmid # 101874 ...
-
bioRxiv - Biophysics 2023Quote: ... pEGFP-N1 was a gift from Antony K Chen (Addgene plasmid # 172281 ...
-
IpaA reveals distinct modes of vinculin activation during Shigella invasion and cell-matrix adhesionbioRxiv - Cell Biology 2023Quote: ... The pmCherry-N1-human vinculin (HV) and was from Addgene. Mutations in D1D2 were transferred in mCherry-HV by exchanging the NheI-PspXI fragment with the corresponding XbaI-PspXI fragment of pET15b-D1D2 ...
-
bioRxiv - Cell Biology 2024Quote: ... LAP2 Full I pAcGFP-N1 monomeric GFP (1317) (Addgene #62044); LBR pEGFP-N2 (646 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...