Labshake search
Citations for Addgene :
551 - 600 of 1731 citations for 1 Methoxy 4 1 methylbutyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC) and the pLKO.1-Hygro (Addgene Plasmid #24150) expressing Nf1 sgRNA (GTTGTGCTCGGTGCTGACTT) ...
-
bioRxiv - Cancer Biology 2024Quote: ... S1 Table) were annealed and cloned into the pLKO.1 vector (RRID:Addgene_8453) (29 ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLKO.1 hygro was a gift from Bob Weinberg (Addgene plasmid # 24150) Other vectors generated during this study are available upon request.
-
bioRxiv - Neuroscience 2023Quote: ... They then had a 1 μL drop of hSynapsin-dependent Cre (Addgene pENN.AA9V.hSyn.Cre.WPRE.hGH ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected with 1 μg of mCherry- Clathrin LC-15 (Addgene) to label clathrin-coated vesicles ...
-
bioRxiv - Neuroscience 2023Quote: ... a 1 μL dot of AAV9/hSyn/GCaMP6f virus (Addgene, Watertown, MA) diluted 1-5x from commercial titer (2.8x1013 to ∼1x1012 units/mL ...
-
bioRxiv - Immunology 2023Quote: ... eGFP was amplified via PCR from pLJM-1-eGFP (Addgene: Plasmid #19319) using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420; http://n2t.net/addgene:87420; RRID:Addgene_87420), AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422 ...
-
bioRxiv - Genetics 2023Quote: ... 2.5 μg of DNA (1 μg of mCherry-expressing plasmid (Addgene, 72264), and 1.5 μg of either pcDNA4/TO-eGFP ...
-
bioRxiv - Genomics 2023Quote: ... were each cloned into pLKO.1 puro lentiviral vectors (Addgene cat. #8453). Lentiviral particles containing each of the shRNA constructs were generated by calcium phosphate co-transfection of HEK 293T cells with the shRNA pLKO.1 puro vectors and separate pMDLg/pRRE packaging and pCMV-VSV-G envelope plasmids generously provided by Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Annealed oligonucleotides were inserted into the pLKO.1-Hygro vector (#24150, Addgene) digested with AgeI and EcoRI ...
-
bioRxiv - Neuroscience 2023Quote: ... all NLS tagged RFP constructs with p-EGFP-N1 (Addgene; 6085-1). To qualitatively verify Cre-dependent ArgiNLS variant expression ...
-
bioRxiv - Neuroscience 2024Quote: ... with 1µl of AAV9-CaMKII-GCaMP6f (Addgene, #100834-AAV9, dilution 1/15) at 0.75µl.min−1 (microinjection pump ...
-
bioRxiv - Molecular Biology 2024Quote: ... The hANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453)54 ...
-
bioRxiv - Neuroscience 2024Quote: ... were subcloned to following vectors: 1.) pCAG-ires-GFP vector (Addgene #45025) with EcoRI and NotI sites for cell electrophysiology experiments ...
-
bioRxiv - Microbiology 2024Quote: ... with the pLenti CMV puro DEST w118-1 plasmid (Addgene #17452, [124]) via LR clonase (Gateway™ LR Clonase™ II Enzyme mix ...
-
bioRxiv - Genomics 2024Quote: Two vector systems: (1) CMV-rtTA-HygR vector (Addgene, Cat No.102423) / and (2 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed mCherry-tagged ATG13 (1-191aa) from a pCAG backbone (RRID:Addgene_223759) together with GST-TEV-ATG101 (RRID:Addgene_171414) ...
-
bioRxiv - Cancer Biology 2024Quote: ... constructs including H2B-iRFP670-p2a-mCerulean-Cdt1 (a.a.1–100) (Addgene, 223965), H2B-iRFP670-p2a-mCerulean-Geminin (a.a.1–110 ...
-
bioRxiv - Cancer Biology 2024Quote: ... MOLM-13-luc cells (1 × 104) stably expressing luciferase reporter (Addgene #46793) were injected through tail vein ...
-
bioRxiv - Neuroscience 2020Quote: ... These vectors are pCXLE- hOCT3/4-shp53-F (Addgene, Watertwon ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of pCMVR8.74 packaging vector (Addgene plasmid #22036) and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene). Mice were also injected unilaterally in the mPFC (1.7 anterior-posterior (AP) ...
-
bioRxiv - Microbiology 2023Quote: ... described in(4) and obtained from Addgene (plasmid # 115809) to produce the HIV-1 LTR-eGFP virus ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (Addgene, 83897-AAV9) viruses were injected in C57Bl6-Jax mice or in some cases in rats ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Neuroscience 2024Quote: pENN.AAV9.CamKII.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9) was added to the cortical organoids at day 278 (1.68×108 GC/well) ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(W276A/I279A/I307A/V310A)-GFP (ΔLIR1+4) (RRID:Addgene_223781), BCL2L13(I224A/L227A/W276A/I279A/I307A/V310A)-GFP (ΔLIR1+3+4 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shCltc1/ shCltc2/ shCltc3 were individually cotransfected with psPAX2 (ADDGENE NO. 12260), pMD2.G (ADDGENE NO ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478) and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453). Lentivirus was generated as described previously (Ferraiuolo et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... High titer (>1012GC/ml) AAV2/1-hSyn-Cre-WPREhGH virus (Addgene 105553-AAV1) was diluted 1:8 or 1:4 in 0.9% saline and 1µl was injected under the forepaw skin ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Rab1060 was obtained from Addgene (#49472) and pET17b-Kif5b(1-560)-GFP-His61 was obtained from Addgene (#15219).
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid #12263) using Fugene 6 (Promega ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV9-CaMKIIα-hChR2(E123A)-EYFP (titer: 1×1013 viral genomes/mL; Addgene: 35505); GAD1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nontargeting shRNA pLKO.1-blast-SCRAMBLE was obtained from Addgene (Catalog #26701). Two shRNAs for each target were obtained and stable lentiviral transductions with the targeted shRNAs and the scramble control were performed ...
-
bioRxiv - Cell Biology 2021Quote: ... The Lentiviral backbone transfer plasmid p-lentiCRISPR - EGFP sgRNA 1 (Addgene Cat #51760) was used to express human codon-optimized Cas9 protein ...