Labshake search
Citations for Addgene :
501 - 550 of 819 citations for Water PCR Grade since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 100µl of the ESCs were then mixed with the scCRISPR construct (Composition: 10µl elute of HDR PCR product; 1µl sgPal7 (Addgene, 71484); 1µl spCas9-BlastR (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... NTR candidates were PCR amplified and cloned into the NdeI and SalI sites of two plasmids: pUCX (Addgene #60681), for biological overexpression assays ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Cell Biology 2019Quote: ... The enhanced green fluorescent protein (EGFP) sequence was amplified via PCR from a pcDNA3-EGFP plasmid that was a gift from Doug Golenbock (RRID:Addgene_13031). The EGFP sequence was cloned in-frame on the N-terminus of TMEM135 in the pTarget vector using BamHI and XhoI restriction enzymes ...
-
bioRxiv - Biochemistry 2021Quote: pGN002: The ECFP encoding fragment was amplified by PCR using primers GNCA005 and GNCA006 (on pcDNA3-CFP, Addgene #13030), followed by DpnI treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272; http://n2t.net/addgene:27272; RRID: Addgene_27272) (Amin et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... guide sequences were PCR amplified from a CustomArray Inc oligo pool and cloned into the lentiGuide-Puro (Addgene #52963) backbone using Golden Gate cloning ...
-
Using optogenetics to link myosin patterns to contractile cell behaviors during convergent extensionbioRxiv - Developmental Biology 2021Quote: ... and the cDNA of CRY2PHR was PCR amplified from the pCRY2PHR-mCherryN1 plasmid from the Tucker Lab (Addgene 26866) (7) ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Biochemistry 2021Quote: A construct encoding residues 109-492 comprising soluble TMPRSS2 ectodomain was amplified by two PCR fragments (Addgene plasmid# 53887) and subcloned into the pFHMSP-LIC C donor plasmid by LIC method ...
-
bioRxiv - Microbiology 2020Quote: ... the human ACE2 gene (Miaolingbio #P5271) was PCR-amplified and cloned into the pLV-EF1a-IRES-blast (Addgene #85133). The human TMPRSS2 and DPP4 gene (Sino Biological #HG13070-CM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Flag-hHOXA1 (pchHOXA1-3XFlag-myc) and Flag-mHoxA1 (pcmHoxa1-3XFlag-myc) were generated by cloning PCR-amplified inserts into a pcDNA3.1 vector (Addgene) featuring a 3XFlag-myc tag sequence in the multiple cloning site ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA sequence encoding the T7 RNA polymerase promoter and sgRNA was amplified by PCR from pHelper_ShCAST_sgRNA vector (Addgene, #127921). The DNA template was then subjected to GeneJet PCR purification (ThermoScientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Histone H2A cDNA were PCR amplified from pCDNA3.1-Flag-H2A and pCDNA3.1-Flag-H2A K118-119R51 (Addgene, #63560, #63564). Histones Macro-H2A cDNAs were obtained for the DKFZ cDNA clone repository.
-
bioRxiv - Immunology 2022Quote: ... pTRIP-hPGK-STING-TurboID was cloned by Gibson assembly of PCR amplified TurboID from V5-TurboID-NES_pCDNA3 (Addgene #107169) and STING from pTRIP-CMV-STING-GFP ...
-
bioRxiv - Plant Biology 2022Quote: ... The LacZ selection marker was PCR amplified with flanking BsaI sites into Level 1 acceptor vector pICH41780 (Addgene #48019) to allow blue-white screening for successful gRNA insertion into final ABE vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This fragment was subcloned with the above PCR fragment using Gibson enzymatic assembly (Gibson et al. 2009) to generate PRE-Hsp70BbCas9_1.0 (Addgene 190795). Gypsy insulator elements were subsequently cloned into PRE-Hsp70BbCas9_1.0 through two Gibson cloning events to generate PRE-Hsp70BbCas9_1.2 (Addgene 190796 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the dFMRP CDS was PCR amplified from pAc5.1-EGFP-dFMRP and transferred into pET-His6-MBP-TEV (Addgene #29656) by ligation-independent cloning following QB3 Macrolab protocols (https://qb3.berkeley.edu/facility/qb3-macrolab/) ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2023Quote: ... each of these systems was PCR amplified and cloned into pTNS2 to replace the parental mini-Tn7 (Addgene #64968) by Golden Gate assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... was cloned with Gibson assembly in frame with the SV40pA sequences that were PCR amplified from lentiCRIPSRv2 (Addgene, #52961). Gibson cloning was subsequently used to simultaneously encompass digested 8xtetO-EF1a promoter-eGFP-SV40pA cassette in frame with the homology arms and the whole insert was cloned into the pSMART-HCKAN (Lucigen ...
-
bioRxiv - Biochemistry 2023Quote: ... at AgeI and NheI sites and fusing PCR amplified CIB1 and spTN (Addgene plasmid # 153002, (Cho et al., 2020a)) using Gibson assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... These sites were subsequently used to introduce the PCR product into linearized pmiRFP670-N1 plasmid (Catalog no.79987, Addgene) using T4 DNA Ligase (Catalog no ...
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... PCR was used to amplify the U6-crRNA scaffold and the DiCas7-11 gene sequence from pDF0114 (Addgene #172508) and pDF0159 (Addgene #172507) ...
-
bioRxiv - Bioengineering 2023Quote: ... The Sp sgRNA plasmids were obtained through PCR- site directed mutagenesis of p426- SNR52p-gRNA.CAN1.Y-SUP4t (Addgene 43803) to introduce the target sequences ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting pU6-chiRNA cassette was amplified by PCR and inserted into the pnos-Cas9-nos plasmid (Addgene #62208) at the NheI restriction site ...
-
bioRxiv - Biochemistry 2023Quote: ... This PCR product was digested with BamHI and BsrGI and cloned into pET-21a-PEmax-6His (Addgene plasmid #204471) digested with the same enzymes ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragment was subcloned in the BamHI and NotI site of pET-28a+GFP-CAMSAP1 CKK (Addgene #59033), which contains 6 histidine (His ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry ORFs were amplified by PCR using pFa6a-mEGFP-kanMX6 (a gift from Julien Berro72, Addgene plasmid # 87023), pAS1NB (a gift from Mark Prescott35 ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-APEX plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and APEX from pcDNA3 APEX-nes (Addgene) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: We PCR amplified Ecad using pEGFP-N1-Ecad plasmid [46] and V5-TurboID using mutant BirA R118S (TurboID) (Addgene [17]) using PCR primers (Table S4) ...
-
bioRxiv - Cell Biology 2020Quote: To generate MCP-NLS-2xYFP, we PCR amplified MCP from CYC1p-MCP-NLS-2xyeGFP (Tutucci et al., 2018) (Addgene #104394) using primer sequenc-es 5’-GAATTGCTCGAGGCCACCATGGCTTCTA-ACTTTACTCAGTTCG and 5’-CTCCGGCATCTAC-CCAAAAAAAAAAAGAAAAGTTATCGATATGG ...
-
Cytonemes coordinate asymmetric signaling and organization in the Drosophila muscle progenitor nichebioRxiv - Developmental Biology 2022Quote: ... The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR (Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB vector (Addgene). 5’HA-T2A-nls:Gal4:VP16-STOP-3’HA was assembled in correct 5’-to-3’ order between Not1 and EcoR1 sites of the pJet1.2 vector.
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2022Quote: ... a fragment containing the GIGYF2 sequence was obtained by PCR from the pcDNA4/TO/GFP-GIGYF2 vector (Addgene plasmid 141189) (34 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified PCR products were fused to biotin ligases via In-Fusion Recombination into myc-BioID2 pBabe (Addgene #80900; XhoI/PmeI), BioID2-HA pBabe (Addgene #120308 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sox2-t2A-mCherry was digested with XbaI and NheI to remove Sox2 and replace with PCR products from Nanog (Addgene plasmid # 59994 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sox2-t2A-GFP was then cut with KpnI and AgeI to remove GFP and replace with PCR-amplified mCherry from pAAVS1-NDi-CRISPRi (Addgene plasmid #73497 ...
-
bioRxiv - Cell Biology 2019Quote: ... the GFP coding sequence was amplified by PCR and inserted into pRS406-ADH1 (p406ADH1 was a gift from Nicolas Buchler & Fred Cross-Addgene plasmid # 15974 ...
-
bioRxiv - Molecular Biology 2019Quote: ... cerevisiae Sth1p bromodomain (residues 1250-1359) was generated by PCR from genomic DNA and cloned into a modified pGEX-4T1 vector (Addgene) using Ligation Independent Cloning (LIC) ...
-
bioRxiv - Cell Biology 2019Quote: The mCherry-DNKASH construct was made from the DNKASH-TSMod construct digested by AgeI/HpaI and mCherry from a PCR on a mCherry-cSrc construct (from M. Davidson, Florida State University, Tallahassee, FL; 55002; Addgene) (fwd ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid and cloning into the EGFP_SV40PA vector downstream of the OmEF1a promoter followed by the modified guide RNA scaffold sequence PCR amplified from gRNA_GFP-T2 (Addgene # 41820).
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplified products were cloned into BsmB1-digested LRG2.1 (a lentiviral sgRNA expression vector, U6-sgRNA-EFS-GFP, Addgene: 108098) using the Gibson Assembly kit (NEB#E2611) ...
-
bioRxiv - Cancer Biology 2019Quote: ... CDKN1A and NRF2 PCR amplicons were prepared with SpeI and MfeI restriction sites and cloned into pEN_TTmiRc2 BirA* (Addgene #136521). Luciferase PCR amplicon was prepared with SpeI and EcoRI restriction sites and cloned into pEN_TTmiRc2 3xFLAG digested with SpeI and MfeI sites (Addgene #136519) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and p53(R280K)-V5 PCR amplicon was prepared with SpeI and MfeI restriction sites and cloned into pEN_TTmiRc2 (Addgene #25752) digested with SpeI and MfeI (Addgene #136520 ...
-
bioRxiv - Neuroscience 2020Quote: ... BirA-HA and HaloTag constructs were PCR-amplified from pcDNA3.1-MCS-BirA(R118G)-HA (a gift from Kyle Roux, Addgene #36047) (Roux et al. ...