Labshake search
Citations for Addgene :
501 - 550 of 907 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Injection mixes were prepared in MilliQ H2O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a sgRNA sequence cutting near MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) was cloned into lentiCRISPR v2 plasmid (Addgene #52961). The Tyrosine to Alanine point mutation was introduced using single-strand Ultramer DNA Oligonucleotide (IDT) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a 3’ untranslated region and terminator sequence (3UTR) from Agrobacterium tumefaciens octopine synthase (AtuOCS) (pICH41432, Addgene #50343). A calibrator construct (pEPYC1CB0197 ...
-
bioRxiv - Immunology 2021Quote: ... an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24 ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al. ...
-
bioRxiv - Cell Biology 2021Quote: tdTomato-ER-3 and LAMP1-Clover (Clover-Lysosomes-20) were gifts from Michael Davidson (Addgene #58097 and #56528). Mito-PhiYFP (pPhi-Yellow-mito ...
-
bioRxiv - Cancer Biology 2023Quote: ... The standard transfection mixture included 3 μg of total DNA [1.5 µg lentiviral plasmid + 1.5 µg helper plasmids - psPAX2 (RRID: Addgene_12260) and pMD2.G (RRID ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 × 106 293T cells were seeded in a 10-cm plate 1 d prior to transfection and co-tranfected with the 3rd generation lentiviral packaging plasmids (5 µg pVSV.G, 3 µg pMDLg/pRRE, and 2.5 µg pRSV-Rev; Addgene # 14888 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmid encoding the sequence of the cleavage site for Caspase 3 (DEVD) and FLIP-GFP reporter (Addgene# 124428) was digested using the NheI_HF and XmaI (New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... using 3 µg of pCAG-NLS-HA-Bxb1 plasmid (a kind gift from Pawel Pelczar (Addgene plasmid #51271) (Hermann et al ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898; http://n2t.net/addgene:83898; RRID:Addgene_83898) 51 to express ArchT 67 fused to TS-EYFP-ER sequence that was cloned from a pcDNA3.1 CMV-ChRmine-TS-EYFP-ER plasmid gift of the Hegemann laboratory at the Humboldt Universität ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Biochemistry 2023Quote: The construct for E.coli expression of WT caspase-3 (pET23b-Casp3-His) was obtained from Addgene (plasmid 11821). The construct for mammalian expression of caspase-3/GFP was a gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... The lin-3 guide sequence was inserted into pDD162 (eef-1A.1p::Cas9 + empty sgRNA, Addgene plasmid #47549) using Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276; http://n2t.net/addgene:73276 ; RRID:Addgene_73276) General yeast manipulation ...
-
bioRxiv - Neuroscience 2024Quote: ... an oligonucleotide pair (Supplemental Table 3) was annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410) as described (Port et al. ...
-
bioRxiv - Microbiology 2024Quote: ... The 5’ p230p and 3’ p230p targeting sequences were cloned into the pPbU6-hdhfr/yfcu plasmid (Addgene #216422),44 carrying the dual positive and negative selection marker hdhfr-yfcu (human dihydrofolate reductase/yeast cytosine deaminase and uridyl phosphoribosyl transferase ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fibroblasts were reprogrammed by electroporation delivery of episomal vectors pCXLE-hOCT3/4-shp53-F (Addgene, 27077), pCXLE-hSK (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected 4 DIV neurons with adeno-associated virus (AAV) expressing CamK2a-Cre (Addgene# 105558-AAV1) - pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Cancer Biology 2023Quote: ... the following lentiviral vectors were used at an MOI of 4 (96h): pWPXL-SOX4 (Addgene 36984), HA-tagged SOX4 [43] or empty vector control (Addgene 12257) ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were injected at 4 weeks of age with pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene viral prep # 105551-AAV9) in the right hemisphere to silence Tsc1 gene and pENN.AAV9.CamKII0.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen-inducible Rosa26::CreERT2 embryo and immortalized by transduction of pMXs-hc-MYC (Addgene 17220) followed by limiting dilution and clone derivation (see “iMEF B” in ref ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ; http://n2t.net/addgene:140957 ; RRID:Addgene_140957)
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 was a gift from Gordon Fishell (Addgene, 162375-AAV9 Addgene) (32) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 was a gift from Gordon Fishell (Addgene, 162375-AAV9 Addgene) (32) ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were transduced with a total of 4 viruses: AAV9-CamKII(0.4)-Cre (Addgene plasmid #105558), AAV9-EF1a-DIO-hChR2(H134R)-EYFP (Addgene plasmid #20298) ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...