Labshake search
Citations for Addgene :
501 - 550 of 2009 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Genetics 2024Quote: ... gfp and unc-54 3’UTR from pPD95.75 (Addgene #1494) using primers P29 and P30 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Genetics 2024Quote: ... with the dU6:3 promoter from pCFD3 (Addgene #49410, [19]). A synthetic gene fragment containing the anti-CRISPR AcrIIa4 codon-optimized for Drosophila was attached downstream of the ϕC31[2] integrase (from pBS130 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mCherry-ER-3 (a gift from Michael Davidson - Addgene plasmid # 55041 ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Individual sgRNAs targeting sites 1-4 of the SABER array were cloned into 4 separate U6x:sgRNA plasmids (Addgene plasmids 64245-64248) as described previously52 ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Genomics 2021Quote: Individual effectors were fused at the N-terminus to the PYL1 domain (gift from Jerry Crabtree, Addgene plasmid #38247) and sfGFP ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521; http://n2t.net/addgene:12521; RRID: Addgene_12521). The pLPC-puro-N-Flag-NELFE plasmid was obtained by amplification of the human NELFE cDNA (obtained from gene synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pGL3-U6-sgRNA-PGK-puromycin and pST1374-N-NLS-flag-linker-Cas9-D10A were gifts from Xingxu Huang (Addgene plasmid # 51133 ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... full-length Prdm16 overexpressing plasmid with an in-frame N-terminal FLAG tag was purchased from Addgene (Addgene #15504). Full-length Dnmt1 cDNA clone was obtained from Open Biosystems and further subcloned into the pLVX lentiviral expression vector (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Biochemistry 2021Quote: ... Jürg Müller (for generation of pcDNA5.1-FRT/TO-puro-(N)GFP-TEV-FLAG-3C-BAP1) or originated from Wade Harper’s laboratory obtained from Addgene (for generation of pcDNA5-FRT/TO-puro-eGFP-BAP1) ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats intended for fiber photometry experiments (n=11 females) received unilateral infusions of AAV9 FLEX-GCaMP6f (0.4uL, titer ∼1.4 × 1013 GC/mL, Addgene #100833) into the VP and retro-AAV Cre (0.4uL ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Cell Biology 2023Quote: ... Human NDP52 cDNA was cloned into a pGST2 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_187828). After the transformation of the pGST2 vector encoding GST-TEV-NDP52 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Biochemistry 2023Quote: ... Linker SAM variants with N terminal HisSUMO-tag were assembled in a pET vector (starting from Addgene Plasmid #111559) for recombinant expression in E ...
-
bioRxiv - Cell Biology 2023Quote: ... from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870). For expression of unlabeled NAP1 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871), NAP1 delta-NDP52 (S37K/A44E ...
-
bioRxiv - Physiology 2024Quote: ... the AAV9-TNT-MCM2 vector was created by amplifying MCM2 cDNA from mEmerald-MCM2- N-22 (Addgene ID: 54164) using forward primer ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein phosphatase was fused to a N-terminal 6xHis-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223747). After the transformation of the pET-DUET1 vector encoding 6xHis-TEV-λ PPase in E ...
-
bioRxiv - Cell Biology 2024Quote: ... or ATG13 (230-517aa) were fused to a N-terminal 6xHis-TEV-mCherry-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223762) or by inserting the coding sequence for ATG13 (191-517aa) ...
-
bioRxiv - Cell Biology 2024Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6xHis tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6xHis-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2024Quote: ... the C-terminal domain of FIP200 (1429-1591aa) was fused to a N-terminal 6xHis-TEV-GFP-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223724). After the transformation of the pET-DUET1 vector encoding 6xHis-TEV-GFP-FIP200(CTR ...
-
bioRxiv - Cell Biology 2024Quote: ... A donor repair template (backbone C-terminal tagging: pHD-DsRed - Addgene #51434; backbone N-terminal tagging: pUC19-Addgene #50005) carrying the tag as well as a loxP-DsRed-loxP eye marker cassette flanked by 600-1000 bp homology regions up- and downstream of the start codons (for N-terminally tagged mCherry::Nup358 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Cell Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Genetics 2021Quote: ... PiggyBac cargo plasmids used in Figure 3 and shown in Extended Data Figure 3 and pegRNA-expressing plasmids used in Figure 4 and Extended Data Figure 4 were created using the Mammalian Toolkit (Addgene article #2819751028), which was a gift from Hana El-Samad (UCSF).
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (BPA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pCMV-VSVG (Addgene 8454), 2 μg pMDLg/pRRE (Addgene 12251) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or lentiCRISPRv.2-hygro (Addgene 98291). Validation of guide specificity was assessed by Western blot of low-passage cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pMDLg/pRRE (Addgene 12251), 2 μg pRSV-Rev (Addgene 12253) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pRSV-Rev (Addgene 12253), and 2 μg lentiviral plasmid carrying transgene (LeGO iG-CDK4R24C ...
-
bioRxiv - Immunology 2021Quote: ... 2 µg PMD2G plasmids (12259, Addgene), 40 µL of P3000 Reagent (Thermo Fisher Scientific) ...