Labshake search
Citations for Addgene :
501 - 550 of 744 citations for Locostatin CAS 90719 30 5 100% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Bioengineering 2020Quote: The piggyBac-BE3-GFP plasmid was constructed by insertion of the BE3-blasticidin fragment into plasmid PB-CA (Addgene #20960). The BE3-blasticidin fragment was obtained by assembly of the BE3 fragment amplified from the pCMV-BE3 vector (Addgene #73021 ...
-
bioRxiv - Cell Biology 2021Quote: Sgo1 was cloned in the pCDNA3-GFP vector (6D) (a gift from Scott Gradia, California Institute for Quantitative Biosciences [QB3], University of California, Berkeley, CA; Addgene plasmid #30127 ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasmid was a generous gift from Viviana Gradinaru (Caltech, Pasadena, CA, USA) and was obtained from Addgene (plasmid # 104061). Immediately after intravenous injection ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human CA-RhoA (a constitutively active mutant of RHOA, RHOAQ63L) was amplified from plasmid pRK5-myc-RhoA-Q63L [bought from Addgene, catalog number #12964] CA-MLCK (constitutively active mutant of human MLCK ...
-
bioRxiv - Genetics 2024Quote: The sgRNA expression plasmids for the various Cas effectors were generated using custom oligonucleotides and restriction enzyme-based classical cloning methods based on pRG2 (no. 104174, Addgene). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Wild-type mice were injected with a retrograde virus encoding Cre recombinase [either CAV-Cre (Montpellier, 100 nL injected undiluted, undiluted titer 1.0 x 1013/mL) or AAV2retro-Cre-mCherry (Addgene/UPenn Vector Core ...
-
bioRxiv - Neuroscience 2020Quote: ... we also injected 100 nL anterograde viral tracer (AAV1-CB7-CI-TurboRFP-WPRE-RBG, 2.2 × 1012 gc/mL, catalog # 105546-AAV1, Addgene) into the ventral posteromedial parvocellularis (VPMpc ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with 100 nL of AAV virus expressing GCaMP6s into three locations within primary visual cortex (AAV1.Syn.GCaMP6f.WPRE.SV40; Addgene 100837-AAV1) at two depths (150 and 300 µm ...
-
bioRxiv - Molecular Biology 2021Quote: The cell cycle reporter vector pCSII-EF-miRFP709-hCdt(1/100) was a kind gift from Vladislav Verkhusha (Addgene plasmid # 80007 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 100 ng/µl of Cas9 mRNA transcribed from the linearized MLM3613 plasmid (Addgene 42251; Dahlem et al., 2012). GFP-positive individuals were crossed to wildtype ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass pipette (tip diameter: ∼100 µm) containing the retrograde AAV-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene #51085) was slowly lowered into the IC at a rate of 1 µm/s using a micromanipulator (Sutter MP-285) ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Neuroscience 2022Quote: ... and 210nl of Arch 3.0- eYFP (rAAV2-EF1a-double floxed-eArch3.0-eYFP; 5 × 1011 GC per ml; UNC Vector Core or eYFP (Addgene plasmid 20296 ...
-
bioRxiv - Neuroscience 2021Quote: Four mice (experimental group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-ChR2-WPRE-eYFP (Addgene viral prep 20298-AAV5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CasX2 ORF was amplified from pBLO 62.5 (pBLO 62.5 was a gift from Jennifer Doudna and Benjamin Oakes, Addgene plasmid #123124; http://n2t.net/addgene:123124; RRID:Addgene 123124) [39] ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected the Cre-dependent constructs AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) and AAV-EF1a-DIO-eNpHR3.0-mCherry-WPRE (5×1012 gc/mL ...
-
bioRxiv - Neuroscience 2023Quote: A volume of 200 nL of pGP-AAV2/5-syn-FLEX-jGCaMP8m-WPRE (1.9×1012 pp/mL, Addgene; #162378) expressing the genetically encoded calcium indicator GcaMP8m was injected into the CA2 region of the right hemisphere at AP -2.0 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Neuroscience 2023Quote: ... Cre-expressing BNST neurons were induced to express eYFP (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; Addgene_27056) for visualization of BNST AVP neurons.
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... This middle entry vector was Gateway recombined using a 5’ entry zebrafish ubiquitious promoter (Addgene #2732, Watertown, MA, USA), a 3’ entry pA vector ...
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected AAV2/5-hSyn-hM4D(Gi)-mCherry (titer: 1.05*1012 gc/ml; a gift from Bryan Roth (Addgene viral prep # 50475-AAV5 ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Cancer Biology 2024Quote: ... The top 5 crRNA spacer sequences were selected and cloned into the pX459v2 Cas9 Puro Plasmid (Addgene Plasmid #62988) using single-step golden-gate cloning ...
-
bioRxiv - Microbiology 2024Quote: ... before co-transfection the next day with 15 µg of the pLVX-3xHA-TurboID-RAB11A plasmid along with 10 and 5 µg of the pΔ8.74 (Addgene #22036) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2024Quote: TRAP2 mice were bilaterally injected in the VTA with 0.3 μl of rAAV-hSyn-DIO-hM3Dq-mCherry (5 × 1012 gc/ml; Addgene), rAAV-hSyn-DIO-hM4Di-mCherry (4.2 × 1012 gc/ml ...
-
bioRxiv - Plant Biology 2024Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
An improved TEAD dominant-negative protein inhibitor to study Hippo YAP1/TAZ-dependent transcriptionbioRxiv - Cell Biology 2024Quote: ... pcDNA3-HA-TAZ 39 and pCMX-GAL4-TEAD1 to 4 5 constructs were a gift from Kunliang Guan (Addgene plasmids 32839 ...
-
bioRxiv - Developmental Biology 2024Quote: ... a hL1-5’_3.3kb plasmid was generated by sub-cloning the 5’ end ∼3.3kb LINE1 sequence from the EF06R plasmid (Addgene # 42940)95 to the backbone of the pU6-sgRosa26-1Cbh-Cas9-T2A-BFP plasmid (Addgene # 64216)96 ...
-
bioRxiv - Cell Biology 2022Quote: CymR was constructed via PCR and Gibson Assembly from the following constructs: pCuo CA Rac1 CMV + cumate operon purchased from Addgene (#84643), human APC open reading frame purchased from Addgene (#16507) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Bioengineering 2020Quote: ... Other CRISPR/Cas endonucleases (SaCas9, Cas12a and CjCas9) were subcloned from pX601-SaCas9 (kindly provided by Feng Zhang; Addgene No. 61591), pcDNA3.1-hAsCpf1 (kindly provided by Feng Zhang ...
-
bioRxiv - Developmental Biology 2020Quote: ... Constitutive active form of mouse ChREBP was subcloned into pMSCVhyg-3xT7 to generate pMSCVhyg-3xT7-CA-ChREBP using full length clone as templates (Addgene #39235). All plasmids were confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Synthetic Biology 2022Quote: DNA for all enzymes used in this study were ordered from Twist Bioscience (CA, USA) or provided by JGI in the vectors pJL1 (Addgene #69496), pD1 ...
-
bioRxiv - Biochemistry 2021Quote: ... grown in a 100 mm plate format were co-transfected with 4.5 μg psPAX2 (Didier Trono lab, Addgene plasmid #12260), 500 ng pMD2.G (Didier Trono lab ...