Labshake search
Citations for Addgene :
501 - 550 of 1089 citations for Dichlorine bis pentane 2 4 dionato o o' platinum since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 µg of the SARS-CoV-2 Np coding plasmid (Addgene, cat.141391) was co-transfected as well ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Microbiology 2021Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446) (Campeau et al. ...
-
bioRxiv - Genetics 2021Quote: The Drosophila CRISPR genome-wide knockout library was previously described and is available from Addgene (134582-4)20,55 ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected with a mixture of Cre-expressing and Cre-dependent adeno-associated viral vectors carrying the genes for ChR2 and tdTomato (AAV9.CamKII.4.Cre.SV40 and AAV9.CAG.Flex.ChR2.tdTomato, Addgene). Following a post-injection survival period of 9 weeks ...
-
bioRxiv - Neuroscience 2023Quote: Viral vectors encoding the fluorescent dopamine indicator dLight1.2 (AAV5-hSyn-dLight1.2) (Addgene, titer ≥ 4×10¹² vg/mL) and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40 ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Cell Biology 2023Quote: Linear tetra-ubiquitin fused to GST (GST-4×Ub) was cloned into a pGEX-4T1 vector (RRID:Addgene_199779). After the transformation of the pGEX-4T1 vector encoding GST-4×Ub in E ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425; http://n2t.net/addgene:61425; RRID:Addgene_61425). lenti MS2-P65-HSF1_Hygro (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... lenti MS2-P65-HSF1_Hygro (4) was a gift from Feng Zhang (Addgene plasmid # 61426; http://n2t.net/addgene:61426; RRID:Addgene_61426). lentiMPH v2 (20 ...
-
bioRxiv - Cell Biology 2024Quote: ... a total of 3.65 μg DNA vectors including 0.47 μg pCE-hOCT3/4 (Addgene, MA, U.S.A, #41813), 0.47 μg pCE-hSK (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 week-old male p62 fl/fl mice were transduced with pAAV.TBG.PI.eGFP.WPRE.bGH (AAV8) (Addgene item #105535-AAV8) or AAV.TBG.PI.Cre.rBG (AAV8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... unc-4 and vab-7 homology arms were cloned into the mNG-SEC plasmid pDD268 (Addgene #132523). Primers are listed in Supplemental Table S1.
-
bioRxiv - Cell Biology 2020Quote: ... the pET30-2-GAPDH plasmids was a gift from David Sabatini (Addgene plasmid # 83910) (Pacold et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327; http://n2t.net/addgene:19327; RRID:Addgene_19327), pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2) EF1α promoter and puro resistance gene were amplified from lentiGuide-Puro (Addgene #52963). 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA of SKAP2WT and SKAP2W336K (see Table 2) was transferred into pLEX_307 (Addgene #41392). For analysis of subcellular localization ...
-
bioRxiv - Microbiology 2021Quote: ... The pCRISPomyces-2 vector used in this study was obtained from Addgene (Code: 617374). All the media and chemicals were used in this study were purchased from Hi-media (Mumbai-India ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×106 cells were co-transfected with Cas9 (pU6_CBh-Cas9-T2A-BFP: Addgene #64323) and gRNA (pSPgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... psiCHECK-2-Sal4-wt_3’UTR was a gift from Robert Blelloch (Addgene plasmid # 31862). psiCHECK-2-Rab GTPases were generated by inserting Rab GTPases into psiCHECK- 2-Sal4-wt_3’UTR by XhoI/NotI.Tetanus toxin light chain (Eisel et al. ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAV plasmids presented in this study are available from Addgene (Supplementary Table 2).
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 gRNA plasmids were generated per construct and were integrated into pX330 (Addgene# 42230) using BbsI site as previously described 16 ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
bioRxiv - Neuroscience 2024Quote: ... For calcium imaging an AAV was injected (AAV1.Syn.GCaMP6m.WPRE.SV40; RRID: Addgene_100841, titre: 2*1012) into the PPC (from Bregma ...
-
The HUSH epigenetic repressor complex silences PML nuclear bodies-associated HSV-1 quiescent genomesbioRxiv - Microbiology 2024Quote: ... plasmids of interest (see plasmids section) were co-transfected with psPAX.2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2024Quote: ... The wild-type SARS-CoV-2 spike plasmid (HDM-SARS2-spike-delta21, Addgene #155130) was cloned with the additional D614G substitution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Vector for CRISPR/Cas9-mediated knock-out of BCL-2 was plentiCTRSPRv2 (Addgene #52961) with gRNA targeting exon 1 in BCL2 ...
-
bioRxiv - Immunology 2024Quote: ... gRNA#2: ATGTTGGCTAGCTGTCGATT (Exon2 ORF bp196-215) and cloned into lentiCRISPRv1 (Addgene, plasmid 49535). After lentiviral transduction using lentiCRISPRv1 as control as described below ...
-
bioRxiv - Plant Biology 2024Quote: ... a level 2 receiver plasmid was constructed by assembling a 35S promoter (Addgene #54406), a LacZ expression cassette flanked by Esp3I sites (Addgene #54458) ...