Labshake search
Citations for Addgene :
501 - 550 of 2974 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 × 106 cells were co-transfected with 5 µg of eSpCas9-hGeminin plasmid (Addgene plasmid, #86613) and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Cell Biology 2024Quote: ... together with 10 µg psPAX2 lentivirus packaging plasmid and 5 µg lentivirus envelope plasmid (gifts from Didier Trono, Addgene #12260 and #12259, respectively) using 90 µL 1 mg/mL Polyethylenimine Hydrochloride (Polysciences ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV-EF1α-DIO-GCaMP6m-WPRE-pA or pAAV-GfaABC1D-EGFP-WPRE-pA) with pAAV-RC2/11 (or pAAV-RC2-retro or pAAV-RC9) and pAdDeltaF6 (Addgene plasmid #112867) were co-transfected into HEK-293T cells at the molecular ratio of 1:1:1 ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Immunology 2020Quote: ... gRNAs were cloned into the pSpCas9(BB)-2A-GFP (PX458) plasmid (a gift from F. Zhang; Addgene, #48138) as described elsewhere [33] and Jurkat cells were transfected with either empty vector or the gRNA-encoding construct using the Nucleofector Solution 2M (5 mM KCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... The gRNA oligonucleotides were inserted into the U6>sgRNA(F+E) vector which was a gift from Lionel Christiaen (Addgene plasmid # 59986 ; http://n2t.net/addgene:59986 ; RRID:Addgene_59986) 52 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The TIS11B coding sequence was amplified from pcDNA3.1-puro-GFP-TIS11B using TIS11B MCP F and TIS11B MCP R primers and the TIAL1 coding sequence was PCR amplified from pFRT_TO_FlagHA_TIAL1 (Addgene 106090) using TIAL1 MCP F and TIAL1 MCP R primers.
-
bioRxiv - Cancer Biology 2024Quote: The pCC_01 - hU6-BsmBI-sgRNA(E + F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE plasmid (Addgene #139086; RRID:Addgene_139086) was used for CRISPR knockout ...
-
bioRxiv - Cancer Biology 2024Quote: The pCC_01 - hU6-BsmBI-sgRNA(E + F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE plasmid (Addgene #139086; RRID:Addgene_139086) was used for CRISPR knockout ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with 75 ng ER_GFP-SBP-AG10 and either 225 ng Ii-Str_Neomycin (A gift from F. Perez, Addgene plasmid #65308 ...
-
bioRxiv - Cell Biology 2024Quote: BBC3 sgRNAs or scramble sgRNAs were designed and cloned into the lentiCRISPR v2 Cas9 backbone (a kind gift from F. Zhang, http://n2t.net/addgene:52961; RRID:Addgene_52961) (109) ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid pcDNA3.1-GFP(1-10) was a gift from Bo Huang5 (Addgene plasmid 70219). The fragment encoding for GFP1-10 was isolated via PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... we unilaterally injected 450 nL AAV9-hSyn-flex-GCaMP7s (≥ 1×10¹³ vg/mL, Addgene)107 into lAcbSh ...
-
bioRxiv - Neuroscience 2023Quote: ... and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40, titer≥1×10¹³ vg/ml Addgene 105558-AAV9) virus was injected in S1 barrel cortex ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 nL pACAGW-ChR2-Venus-AAV1 (Addgene cat#20071, titer ≥ 1×10¹³ vg/mL) was released to express ChR2 throughout the cortical layers and their outgoing axons for a long-range CRACM experiment measuring reciprocal connectivity in the visual cortex (FBLM→V1 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and four small injections of a mixture of 1:20 AAV-hSyn-GCamP7f (104488-AAV9, Addgene, 1×10¹³ vg/mL) and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reference sgRNA sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV8-hSyn-DIO-hM4D(Gi)-mCherry (gift from B. Roth; Addgene viral prep # 44362-AAV8), pAAV8-hSyn-DIO-hM3D(Gq)-mCherry (gift from B ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV8-hSyn-DIO-hM3D(Gq)-mCherry (gift from B. Roth; Addgene viral prep 44361-AAV8), AAV8-Ef1a-DIO-mCherry (gift from B ...
-
bioRxiv - Cancer Biology 2021Quote: PDXO cells were transduced with pHIV-Luc-ZsGreen (a gift from B. Welm; Addgene# 39196), pLKO.1-Scr-TD or pLKO.1-Cys-TD as previously described (Tavora et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type I-B Anabaena variabilis ATCC 29413 CAST was sub-cloned from Addgene (#168137) [16] ...
-
bioRxiv - Microbiology 2023Quote: ... this plasmid was used in a Golden Gate reaction using pMB1-B (Addgene number 190115) and BsaI-HF (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μl of AAV2/5-GfaABC1D-Lck-GCaMP6f (1013 genome copies/ml) (Addgene viral prep # 52924-AAV5) was injected into the DLS ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9; https://www.addgene.org/100833/RRID:Addgene_100833) was injected unilaterally into the DS (L = ±1.5 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Immunology 2023Quote: Expi293F cells were cultured and transiently transfected with the pLenti-palmGRET reporter plasmid encoding the dual reporter palmitoylated EGFP-nanoluciferase protein (PalmGRET) (Addgene plasmid #158221 11) for EV production as described previously 23 ...
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Neuroscience 2024Quote: ... sequence along with the P2A sequence (2A peptide from porcine teschovirus-1 polyprotein) at the 3’ end was obtained via PCR from Addgene plasmid #129102 and fused in-frame with the mTurquoise2 DNA sequence in the same plasmid backbone as the pAAV-hSyn-mTurquoise2 plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...