Labshake search
Citations for Addgene :
451 - 500 of 1802 citations for Recombinant Human Fms related Tyrosine Kinase 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... we overexpressed lamin A by transiently transfecting the intact cells with m-Cherry tagged plasmid DNA for lamin A which was a gift from Michael Davison (Addgene, plasmid # 55068). To surpass lamin A expression ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Genomics 2020Quote: ... Mediator and PIC components were tagged with 3xFLAG using pFA6a-6xGLY-3xFLAG-hphMX4 (Funakoshi and Hochstrasser, 2009) (a gift from Mark Hochstrasser, Addgene plasmid #20755) or a derivative thereof in which the hphMX4 marker is replaced with a TRP1 cassette (pGZ392) ...
-
bioRxiv - Molecular Biology 2021Quote: FUS-ΔIDR-SHARP was generated by recombining the ΔIDR-SHARP entry clone into a modified version of the PB-HALO-IRES-NGFR vector containing the IDR sequence from the FUS protein tagged with mCherry (Addgene plasmid 101223) in place of HALO ...
-
bioRxiv - Molecular Biology 2019Quote: CRISPR-Cas9-mediated generation of endogenously tagged lines was through injection of pU6-BbsI-chiRNA plasmids (Addgene:466294; (Gratz et al., 2013)) along with pBS donor plasmids containing 1 kb long homology arms into act-Cas9 embryos (Bloomington stock ...
-
bioRxiv - Biochemistry 2021Quote: ... and mouse cDNA sequences for GFP-tagged ENAH, VASP, and EVL (gifts from Frank Gertler, MIT) were sub-cloned into the pCIB lentiviral expression vector (Addgene plasmid #120862) as previously described (Puleo et al ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2000 ng total plasmid DNA per dish including the 50-1000 ng FP-tagged encoding plasmids supplemented with an empty plasmid vector (pCAG-FALSE, Addgene plasmid #89689) depending on the aimed fluorescence level [35] ...
-
bioRxiv - Cell Biology 2021Quote: ... Atg18 and CSC have been C-terminally tagged with either Gly6-FLAG3::kanMX4 (available on Addgene #20754; Funakoshi et al Yeast. 2009), yomCherry::kanMX4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pBABE-CXCL12α and pBABE-CXCL12γ were constructed by inserting CXCL12α or CXCL12γ cDNA containing C-terminally C9-tagged (TETSQVAPA) sequences into pBABE-puro (Addgene plasmid # 1764). Lentiviral and retroviral particle production and transduction were performed as described before29.
-
bioRxiv - Immunology 2022Quote: ... pTRIPZ-puro-HA-Ub was generated by Gibson assembly by PCR amplification of HA-tagged ubiquitin gene from the plasmid HA-Ubiquitin which was a gift from Edward Yeh (Addgene plasmid # 18712) and pTRIPZ-puro digested with AgeI and XhoI ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmids were then transformed into the strains to enable detection of MS2 and PP7-tagged mRNAs The MS2 and PP7 tagging reagents were gifts from Jeff Gerst and Robert Singer (Addgene #31864 & #35194) (Haim-Vilmovsky and Gerst ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: After co-transfection for 36 hours with plasmid DNA encoding the relevant SNAP-tagged receptor (1 μg) and AKAR4-NES (1 μg; a gift from Dr Jin Zhang, Addgene plasmid #647270), wild-type or dual β-arrestin knockout HEK293 cells were suspended in HBSS in black 96 well plates ...
-
bioRxiv - Cell Biology 2021Quote: ... ATM knockout C20 lines were generated using the AIO-GFP vector encoding GFP-tagged SpCas9(D10A) nickase (kind gift of Steve Jackson; Addgene plasmid #74119) (66 ...
-
bioRxiv - Cell Biology 2023Quote: MDCK cells expressing GFP-Rab19 on the Rab19 KO background were lysed and incubated with GST-tagged anti-GFP nanobody (recombinantly produced from pGEX6P1-GFP-Nanobody, Addgene Plasmid #61838) or with free GST for negative control ...
-
bioRxiv - Microbiology 2023Quote: ... was used as the template for preparation of short constructs as well as egfp-tagged constructs in pHis17 vector (Addgene plasmid #78201) by restriction-free (RF ...
-
bioRxiv - Neuroscience 2024Quote: ... pro-lentiviral vector1 containing a 476 bp human synapsin-1 promoter element driving the neuronal specific expression of HA-tagged SpCas9 flanked by the bipartite SV40 nuclear localization signal (NLS) HA-NLS-SpCas9-NLS (from Addgene, plasmid #131497) at AgeI and BsrGI sites followed by woodchuck hepatitis post-transcriptional regulatory element (WPRE ...
-
bioRxiv - Molecular Biology 2021Quote: ... and TopBP1 was produced as a fused protein with a GST-tag (GST TopBP1 (aa 32-1522) His from Addgene; plasmid # 20375) ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The EcoRI-HpaI fragment of wild-type or mutant Claspin DNA from mAG-TEV-His-Claspin-Flag3 was inserted at the EcoRI/SnaBI site of pMX-IP (Addgene) to construct retroviral expression vectors ...
-
bioRxiv - Biochemistry 2021Quote: ... and all described mutants were independently cloned and expressed as a 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). These were cloned utilizing primers in Table S3 ...
-
bioRxiv - Biochemistry 2020Quote: FUS LC and FUS LC 12E, soluble His-tag purifications as described (Monahan et al., 2017) (Addgene ID: 98653, 98654)
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Neuroscience 2022Quote: ... An adeno-associated virus (AAV) solution expressing the CaMPARI2 sensor (hsyn-NES-his-CaMPARI2-WPRE-SV40, Addgene catalog number 101060) was injected into two locations ...
-
bioRxiv - Biochemistry 2023Quote: ... the C162A mutant and the C162L mutant were independently cloned and expressed as 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). BL21 (DE3 ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmids for his-FUSLC (residue 1 to 163) and LAF-1 RGG (residue 1 to 168) were acquired from Addgene (https://www.addgene.org/127192/ (Fawzi laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment encoding integrin β4 was amplified from pcDNA3.1/Myc-His beta4 (a gift from Filippo Giancotti, Addgene #16039), and then inserted into the pEGFP-N1 vector for the expression of β4-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... Obtained pcDNA-Halo was further digested with HindIII/Bam-HI restriction enzymes and ligated with the NPM insert (obtained by PCR amplification from eGFP-NPM (17578 Addgene) with our primers 5’-CCCAAGCTTCCACCATGGAAGATTCGATGGACATGG-3’ and 5’-CGGGATCCAAGAGACTTCCTCCACTGCC-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Genetics 2020Quote: sgRNA sequences targeting human USP15 were selected from the Human Brunello CRISPR knockout pooled library (Doench et al., 2016)(Addgene #73178) and further selected on the basis of high quality score in two additional online tools ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified human KEAP1 and LKB1 off of human cDNA and used Gibson assembly to replace GFP in pMCB306 (Addgene #89360) with these sequences ...
-
bioRxiv - Biophysics 2024Quote: Human RING1b (Uniprot ID Q99496) and human BMI1 (Uniprot ID P35226) were cloned into a pFBOH-mhl vector (Addgene plasmid # 62304) cleaved with BseRI using Gibson Assembly® Master Mix (NEB #E2611L ...
-
bioRxiv - Cell Biology 2024Quote: ... The TRPML1-GCamP6s expression construct was created by subcloning the human TRPML1 insert from the human TRPML1-EYFP plasmid 63 into the pGP backbone harboring GCaMP6s (Addgene #40753) using restriction sites BglII (N-terminal ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two guide RNA sequences were selected to target exon 1 of mtIF3 as described previously (5′-GCAAUAGGGGACAACUGUGC-3′ and 5′-GCAGAGUAUCAGCUCAUGAC-3′) 59 and cloned into the pL-CRISPR.EFS.GFP (a gift from Benjamin Ebert, Addgene plasmid # 57818 ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Genetics 2022Quote: Recombinant AAV-PHP.eB [13] was packaged in AAVpro 293T cells by co-transfection of PHP.eB (Addgene, 103005), pHelper (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...