Labshake search
Citations for Addgene :
451 - 500 of 668 citations for IGFBP 7 Mouse HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Microbiology 2021Quote: A 2933 bp in vitro DNA synthesized IRES-vpr mKO fragment was ordered from Genewiz (South Plainfield, NJ) using an IRES sequence from pTRIPZ-hDDX5/7 (Addgene Plasmid #71307) (64 ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Neuroscience 2022Quote: ... Following AAVs were used: AAVrg-CAG-FLEX-rc[Jaws-KGC-GFP-ER2] (titer >7×1012 vg/ml, viral prep #84445-AAVrg, Addgene, US,34) or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml ...
-
bioRxiv - Cell Biology 2021Quote: HEK-293T cells plated on polylysine-coated coverslips were transfected with cDNA (100 ng/40000 cells) coding for mitochondrial-targeted mCherry (mCherry-Mito-7, a gift from Michael Davidson (Addgene plasmid # 55102), (Olenych et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR-mediated gene disruption was performed by identifying individual gRNA sequences with consistent enrichment in LDLlow cells in our previously reported CRISPR screens [7] and cloning these sequences into the BsmBI sites of pLentiCRISPRv2 (Addgene #52961, [43]) or into the BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Molecular Biology 2023Quote: Firefly and Renilla luciferase expression plasmids were cloned by standard methods starting with the pGL3 PUb-luc plasmid described previously (7) and pSLfa-PUb-MCS (Addgene plasmid # 52908). Transgenesis plasmids were generated using NEBuilder HiFi Assembly Master Mix (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells transiently co-expressing individual GFP-tagged RUSH reporter and GalT-mCherry were cultured in complete DMEM supplemented with16 nM His-tagged streptavidin (in-house purified using Addgene #20860, a gift plasmid from A. Ting)(Howarth et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Bioengineering 2019Quote: ... Neurons were dissociated and seeded on 4 different MEAs at ~3000 cells/mm2 over the electrode area and cultured in NbActiv1™ medium for at least 7-14 days prior to transfection with Fubi-ChR2-GFP (Addgene plasmid # 22051) or 21 days prior to transfection with C1V1tt (Addgene plasmid # 35497) ...
-
bioRxiv - Neuroscience 2024Quote: ... and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene, titer: ∼7×1012) into the NAcore ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Cell Biology 2021Quote: Plasmid pT7-7 α-Syn A53T for the expression and purification of recombinant α-Syn was a gift from Hilal Lashuel (Addgene plasmid #10572784) and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Neuroscience 2022Quote: ... CON and DEP/MS male offspring underwent stereotaxic surgery to virally inject either pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Excitatory DREADD; Addgene #44361, titers: 7×1012 vg/ml) or pAAV-hSyn-DIO-mCherry (Control mCherry reporter ...
-
bioRxiv - Neuroscience 2022Quote: ... Three injections of AAV9-rTH-PI-Cre-SV40 (functional, titer >7×1012 vg/ml, viral prep #107788-AAV9, Addgene, US, a gift from James M. Wilson) or were made analogously to spinal injections ...
-
bioRxiv - Genomics 2022Quote: ... Snai1 and Srebf2 to the pINDUCER21 Dox-inducible lentiviral vector (Meerbrey et al. 2011) using the services of Genscript (Addgene #46948, Supplementary Figures 6 and 7). We used the pINDUCER21 system since it allows us to control the level of over-expression of a gene with precision by adding different levels of Doxycycline to the cell growth media ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...