Labshake search
Citations for Addgene :
451 - 500 of 1063 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: The pNLS-mTagBFP2 plasmid used as an internal control of transfection efficiency was obtained by PCR amplification of the 2xNLS-mTagBFP2 coding sequence with mTagBFP-Acc65-F and mTagBFP-Mlu-R primers on the pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2 plasmid template (a gift from Thoru Pederson ; Addgene plasmid # 64512 ...
-
bioRxiv - Bioengineering 2024Quote: ... the kanamycin-resistance gene AphAI flanked by an I-SceI restriction site (I-SceI-AphAI fragment) was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017 ...
-
bioRxiv - Cell Biology 2024Quote: ... The target sites were PCR amplified with primers containing gRNA target sequences using the pCBC-DT1T2 vector as a template (Addgene plasmid # 50590 ...
-
bioRxiv - Cell Biology 2024Quote: ... the second BsmBI site and the 3’ part of the padlock recognition sequence (ACTGGCTATTCATTCGC) followed by an RT primer binding site (CCTTTGGGTAAGCACACGTC) (Fig. 2B, plasmid deposited on Addgene). We then synthesized three pegRNA sublibraries corresponding to 48 ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...
-
bioRxiv - Neuroscience 2022Quote: ... The V5-tagged human GLUT1 construct was a gift from Wolf Frommer (Addgene) 89 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The designed sgRNAs were cloned into human lentiCRISPR v2 vector (Addgene, MA, USA). For lentiviral packaging ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T target cells transfected with 500ng of a human ACE2 expression plasmid (Addgene) were seeded at 2×104 in 100μL DMEM-10% in a white-bottomed 96-well plate (Corning ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Bioengineering 2022Quote: ... we utilized the Human Genome-wide CRISPRa-v2 Library (Addgene Pooled Libraries #83978) consisting of 104,540 sgRNAs targeting 18,915 genes (top 5 sgRNAs per gene) ...
-
bioRxiv - Cell Biology 2022Quote: Point mutations were generated on a human fibronectin pMAX vector plasmid (Addgene, #120402) using the Q5 site-directed mutagenesis kit (BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: Human ATG9A was amplified from pMXs-puro-RFP-ATG9A from Addgene (plasmid #60609) and subcloned into the EGFP-N1 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... Brunello library targeting all human protein-coding genes28 was purchased from Addgene (#73179). Quality of the MYC-CRISPR and Brunello libraries was verified by next-generation sequencing on Illumina platform (BGI ...
-
bioRxiv - Molecular Biology 2024Quote: The gRNA library targeting >1500 human miRNA loci was obtained from Addgene (32). MutuI cells were transduced with lentiparticles derived from the doxycycline inducible Cas9 vector pCW-Cas9 (Addgene Plasmid #50661 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Biochemistry 2024Quote: An expression plasmid of human GST-Cdk2 was purchased from AddGene (plasmid #61845) and used without further subcloning ...
-
bioRxiv - Biophysics 2024Quote: The coding sequence of human fascin1 (GeneBank, NM_003088.4) was obtained from Addgene (#31207) and subsequently inserted into a pGEX-6p-1 vector (Cytiva ...
-
bioRxiv - Cell Biology 2023Quote: A vector expressing HA-tagged human E6AP was obtained from Addgene (Plasmid #8658), E6AP mutants were generated using site-directed mutagenesis (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MCU-GFP plasmid was a gift from Vamsi Mootha (Addgene plasmid # 31732).
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CRISPR Knockout library was a gift from Michael Bassik (Addgene #101927). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... All the sgRNAs targeting human genes were cloned into lentiCRISPR v2 (Addgene, #52961), lentiCas9-Blast (Addgene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human CDKN1A (p21) was amplified from plasmid Flag p21 WT [bought from Addgene, catalog number #16240] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human Cdh1 (ECAD) was amplified from plasmid E-cadherin-GFP [bought from Addgene, catalog number #28009] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human CDKN1B (p27) was amplified from plasmid pcDNA3-myc3-p27 [bought from Addgene, catalog number #19937] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human CDKN2A (P16INK4a, p16) was amplified from plasmid pQCXIH-CDKN2A [bought from Addgene, catalog number #37104] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human Cdh3 (PCAD) was amplified from plasmid pcDNA3 P-cad [bought from Addgene, catalog number #47502] ...
-
bioRxiv - Pathology 2024Quote: ... The expression plasmid for the GST-tagged human NEK1 was purchased from Addgene. In order to generate the NEK1t mutant ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human PDAC cells were first infected with a pLentiCas9-Blast vector (Addgene, #52962) for a constitutive Cas9 expression and selected with Blasticidin (AG Scientific ...
-
bioRxiv - Immunology 2024Quote: A plasmid containing the CDS of human SLC7A2 (pDONR221_SLC7A2) was purchased from Addgene. A custom plasmid (pTwist-CMV ...
-
bioRxiv - Cancer Biology 2024Quote: The human PLK1 gene was cloned into the pInducer20 vector (Addgene plasmid #44012) [30] using the Gateway® LR Clonase® II Enzyme Mix (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... we inserted human LC3/GBRP cDNA in a pGEX-4T1 vector (RRID:Addgene_223726; RRID:Addgene_216836; RRID:Addgene_223727; RRID:Addgene_223728 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human NLRP3 from pEGFP-C2-NLRP3 (gift from Christian Stehlik (Addgene plasmid # 73955)) was inserted into an mCherry-C2 mammalian vector by Gibson assembly cloning (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... we inserted human LC3/GBRP cDNA in a pGEX-4T1 vector (RRID:Addgene_223726; RRID:Addgene_216836 ...
-
bioRxiv - Developmental Biology 2021Quote: ... two guideRNAs were designed to flank the target exon coding the β1-2 loop (see Table EV1 for primer sequences) and cloned into the guide RNA expression pCFD4 vector (Addgene #49411). The exon of interest and homology arms were cloned into donor template plasmid pHD-ScarlessDsRed (Addgene # 64703 ...
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...