Labshake search
Citations for Addgene :
451 - 500 of 1689 citations for Human Chemokine C X C Motif Receptor 6 CXCR6 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... The eluted fractions were then pooled together and underwent TEV cleavage overnight at 4°C (TEV protease was purified using the plasmid pRK793, #8827 from Addgene, a gift from David Waugh Lab).
-
bioRxiv - Cancer Biology 2023Quote: Retroviral vectors expressing the cDNA of wild-type c-Myc and GFP in the murine stem cell virus backbone were purchased from Addgene (MSCV-Myc-IRES-GFP, Plasmid #18770). Doxycycline-inducible constructs were obtained by cloning c-Myc cDNA into GC385-S backbone ...
-
bioRxiv - Biochemistry 2023Quote: ... Ttyh1 was expressed from a pLX304 vector after addition of C-terminal Strep and His tags to an existing construct (Addgene #161676, a gift from Mike McManus). To stably express fluorescently tagged Prom1 WT and W795R variants in HeLa cells for live cell imaging ...
-
bioRxiv - Neuroscience 2019Quote: ... Expression of soma-targeted-ChrimsonR was achieved by stereotaxic injection of AAV serotype 1 carrying ChrimsonR-EYFP fused to a Kv2.1 somatic lo alization motif (“fle - ChrimsonR-EYFP-kv”, Addgene plasmid #135319). Injections were made into right visual cortex of mice aged between P26-P53 ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129) was a gift from Xiaolu Yang (Addgene plasmid # 59743)51 ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Cell Biology 2024Quote: ... Fragment containing the RFP dropout cassette and the fragment containing the RFP cassette along with the mpknot motif were separately amplified from pU6-pegRNA-GG-aceptor (Addgene #132777) and pU6-tmpknot-GG-acceptor (Addgene #174039) ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
bioRxiv - Bioengineering 2020Quote: ... The ScFv library with the N-terminal CD8α signal peptide was fused to the synNotch-Gal4VP64 receptor backbone (Addgene plasmid #79125) in place of the CD19-specific scFv ...
-
bioRxiv - Molecular Biology 2020Quote: ... Immortalized Smarca4AID/AID preadipocytes were infected with retroviral vector expressing the auxin receptor Tir1 of rice (pBabePuro-OsTir1-9Myc, Addgene #80074). To induce degradation of SMARCA4 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Enhanced serotype inhibitory Designer Receptors Exclusively Activated by Designer Drugs (DREADD) vectors used were AAV-PHP.eB-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, ME) (Chan et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned CreERT2 (Cre recombinase fused to a mutant ligand-binding domain of the estrogen receptor) and IRES into the BamHI site of pAAV-EF1a-tdTomato-WPRE-pGHpA (Addgene #67527). To prevent leakage of Cre activity34 ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1B and 8B; Penn Vector Core; 1.4 x 1013 for muscle injections; else used at 2.8 x 1012; Addgene plasmid #18917); AAV9-CAG-FLEX-EGFP (Suppl ...
-
bioRxiv - Neuroscience 2021Quote: ... 5B and Suppl. Fig. 8B-D; UNC Vector Core; 4.0 x 1012 and Penn Vector Core; 4.25 x 1012; Addgene plasmid #20298); AAV1-EF1a-DIO-hChR2(H134R)-mCherry (Fig ...
-
bioRxiv - Neuroscience 2023Quote: ... virus titer 2.7 x 1013 (AddGene Plasmid #105540). The skull was sealed with bone wax (Med Vet International ...
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Cell Biology 2019Quote: ... The K18-Scarlet-I reporter was constructed by cloning a fusion of the K18 construct from pMK1253 in frame with the C-terminal mScarlet-I (Addgene #98839, a gift from Dorus Gadella (65)) as well as replacing the EF1a promoter with a CAG promoter to obtain pJC49.
-
bioRxiv - Microbiology 2019Quote: ... respectively (gifts from Seokjoong Kim, Feng Zhang and Erik Sontheimer) into the AgeI and NotI sites of pCAG-CFP (Addgene plasmid 11179; a gift from C. Cepko). Human codon optimized Acr constructs containing a C-terminal SV40 nuclear localization signal were generated by isothermal assembly of synthetic gene fragments (Twist Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... We then synthesized the NMM motif (sJP203) following the sequence from the pONSY-coNMM:mCherry vector (Addgene #111878, (Parra-Acero et al., 2018)) and cloned this DNA fragment into a KpnI digest of pJP115 using Gibson assembly.
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: After co-transfection for 36 hours with plasmid DNA encoding the relevant SNAP-tagged receptor (1 μg) and AKAR4-NES (1 μg; a gift from Dr Jin Zhang, Addgene plasmid #647270), wild-type or dual β-arrestin knockout HEK293 cells were suspended in HBSS in black 96 well plates ...
-
bioRxiv - Microbiology 2020Quote: ... and mutants of ORF68 were subcloned from their respective pcDNA4/TO vectors into linearized pUE1-TSP vector using InFusion cloning to generate expression constructs (Addgene #x-x).
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x). Mutations in ORF68 (Addgene #x-x ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL, Addgene # 114472) or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2024Quote: ... The human RAB6Q72L was subcloned from Addgene plasmid #49483 into a bacteria expression pGEX-4T-1 vector encoding a N-terminal GST tag followed by a TEV cleavage site.
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cell Biology 2021Quote: pG-LAP1 (pCDNA5/FRT/TO-EGFP-TEV-Stag-X) and pG-LAP5 (pEFα-X-Stag-PreScission-EGFP) were from Addgene (Torres et al., 2009). pENTR223-ARL13B fusion construct was from DNASU (HsCD00511796) ...
-
bioRxiv - Microbiology 2020Quote: The expression plasmid for ORF68 was previously described (Addgene #x) and is a pHEK293 UltraExpression I vector (pUE1-TSP ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV9.CAG.Flex.GCaMP6s.WPRE.SV40 (1.9 x 1013 vg/ml, Addgene) or pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE (titre 2.1 x 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1.Syn.FLEX.jGCaMP8s.WPRE (Addgene, lot. no. v111208, titer 2.3 x 1013), AAV1.hSyn.FLEX.iGluSnFR3.v857.PDGFR (University of Zurich ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x 1013). For GCaMP expression in the DRG neurons ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...