Labshake search
Citations for Addgene :
451 - 500 of 787 citations for GPIHBP1 Human HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048),pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230), and lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-cas9-based guide RNA (gRNA) targeting human EED (GATCATAACCAACCATTGTT) was cloned in LentiCRISPR v2 (Addgene 52961), which was mixed with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which covered ~19,000 genes with 4 sgRNAs per gene along with 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Microbiology 2020Quote: Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat and obtained from Addgene (#90294). It is a one-component library with guide-RNAs inserted in lentiCRISPRv2 backbone as well as the cas9 gene ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Microbiology 2022Quote: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) and amplified according to instructions ...
-
bioRxiv - Immunology 2022Quote: ... pEGFP-LC3 (human) was a kind gift from Toren Finkel (Lee et al., 2008) (Addgene plasmid # 24920).
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR–Cas9 screen was performed using the whole genome human Brunello CRISPR knockout pooled library (Addgene #73178) (PMID ...
-
bioRxiv - Biochemistry 2023Quote: A pProEx-IDE-wt (#99014) plasmid containing cloned human IDE (Met42–Leu1019) was purchased from Addgene (UK). The plasmid encoded a 6-histidine tag at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2023Quote: ... human RXRa cDNA was PCR-amplified from pSV-Sport-RXRα (a gift from Bruce Spiegelman; Addgene #8882)68 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human melanoma cell lines with fluorescent BRN2 reporter were further transduced with pHIV-Luc-ZsGreen (Addgene 39196) and selected with neomycin (800 μg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Reads were then mapped to a FASTA file generated from the Bassik Human CRISPR Knockout Library (Addgene), clipped to remove one nucleotide at the 5’ end of each read (due to an excess of mismatches at this position) ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid containing iGluSnFR(A184S) under the control of the human synapsin promoter was purchased from Addgene (#106174) and packaged in the AAV8-Y733F serotype 55 ...
-
bioRxiv - Cell Biology 2023Quote: ... a human colon line (HUB-02-A2-040) was lentivirally transduced with pGK Dest H2B-miRFP670 (Addgene). Lentiviral transduction was performed on single cells after 0.05% Trypsin EDTA (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: Human OGG1 WT or OGG1 K249Q in a pET-His6-GFP-TEV bacterial expression vector (Addgene #29663) were obtained from GenScript ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Molecular Biology 2019Quote: ... wildtype or BRCA2-knockout HeLa cells were transduced with the Brunello Human CRISPR knockout pooled library (Addgene, 73179).10 To achieve a representation of 250 cells per sgRNA ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid expressing the human ACE2 protein with a C-terminal C9 tag was obtained from Addgene (Plasmid 1786). 293T cells were transduced with retroviral particles carrying a pQCXIP vector encoding the gene for the human ACE2 protein ...
-
bioRxiv - Genetics 2021Quote: ... and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498)) or the catalytic domain (CD ...
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral particles were produced in the Human Embryonic Kidney 293T (HEK293T) cell line with the psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full-length wild-type cDNA of human BRCA2 was subcloned from pcDNA3 236HSC WT (Addgene plasmid # 16246) into the piggyBac vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... Briefly three different sgRNAs targeting human SAMHD1 were designed and cloned into lentiCRISPR v2 vector (Addgene plasmid # 52961). Packaging 293T cells were transfected with SAMHD1 sgRNAs (CRISPR SAMHD1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207; http://n2t.net/addgene:22207; RRID:Addgene_22207).
-
bioRxiv - Microbiology 2021Quote: ... Flag-tagged full-length Human gamma-catenin construct in the pcDNA3 vector was obtained from Addgene (plasmid #16827).
-
bioRxiv - Microbiology 2021Quote: The human genome-wide Brunello Library (Doench et al., 2016) in lentiCRISPRv2 was obtained from Addgene (cat# 73179) and amplified according to depositor’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene). Full-length EGFP fused N-terminally to a nuclear localization signal (NLS ...
-
bioRxiv - Microbiology 2020Quote: ... Human CRISPRi pooled library (Dolcetto) was a gift from John Doench (Broad Institute, also available on Addgene #92385). For the secondary screens ...
-
bioRxiv - Cancer Biology 2020Quote: ... the optimized sgRNA lentiviral expression vector (LRG2.1T) and the lentiviral human codon-optimized Streptococcus pyogenes Cas9 vector (LentiV_Cas9_Puro, Addgene: 108100) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... pBabe-puro plasmids containing human C/EBPB LAP2 and LIP isoforms were from Addgene (Cat.# 15712 and 15713).
-
bioRxiv - Cancer Biology 2022Quote: ... human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cat. No. 44719). Two chimeric guide RNA expression cassettes containing two of the following sgRNAs (sgRNA1 ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid expressing FLAG-tagged wild-type human HDAC1 was a gift from Eric Verdin (Addgene Plasmid # 13820). HCT116 cells were transfected in 10 cm plates with 8 μg plasmid and 40 μl PEI ...
-
bioRxiv - Biophysics 2022Quote: ... pET15b CnA CnB, which contains human PPP3CA and PPP3R1 (Mondragon et al., 1997) was obtained from Addgene (11787). Plasmid pQE30 CaM containing rat Calmodulin (protein sequence 100% identical to human ...
-
bioRxiv - Molecular Biology 2019Quote: ... Complemention of timeless was achieved by transfection of plasmids encoding the human Timeless WT cDNA (Addgene plasmid 22887), or truncated versions thereof ...
-
bioRxiv - Neuroscience 2022Quote: ... Mammalian cells were transfected with either the empty vector (pAAV) or human WT aSyn pAAV vector (Addgene plasmid # 36055; http://n2t.net/addgene:36055 ; RRID:Addgene_36055).
-
bioRxiv - Cancer Biology 2022Quote: ... Human SUZ12 cDNA was cloned into pLV-EF1α-IRES-Puro (gift from Tobias Meyer, Addgene Plasmid #85132, RRID:Addgene_85132). MAVS sgRNA was cloned into LRG2.1_Puro (gift from Christopher Vakoc ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human SUZ12 cDNA was cloned into pLV-EF1α-IRES-Puro (gift from Tobias Meyer, Addgene Plasmid #85132, RRID:Addgene_85132). MAVS sgRNA was cloned into LRG2.1_Puro (gift from Christopher Vakoc ...
-
bioRxiv - Molecular Biology 2019Quote: Full length wild type human DHX30 cDNA corresponding to transcript (ENST00000348968.8) was cloned into the TetON lentiviral vector pCW57.1 (Addgene), exploiting the Nhe I and Age I restriction endonucleases ...
-
Comparative performance of the BGI and Illumina sequencing technology for single-cell RNA-sequencingbioRxiv - Genomics 2019Quote: Comprised of cultured human trabecular meshwork cells (TMWCs) that had been transfected with a CROP-seq (Addgene: 99248) guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2020Quote: cDNAs for human prostate cancer TMPRSS2-ERG fusion was cloned into retroviral-based vector MSCV-C-HA (Addgene). Retrovirus was produced in 293T cells by standard methods using Ampho packaging vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCh-hRab7A (#922) plasmid encoding mCherry-labeled version of human Rab7A protein was from Addgene (Cat# 61804). GFP-hRab5A.dn3 (#966) ...
-
bioRxiv - Cell Biology 2021Quote: The RFP-hRab5A.dn3 (#921) plasmid encoding RFP-labeled version of human Rab5A protein was from Addgene (Cat# 14437). The mCh-hRab7A (#922 ...
-
bioRxiv - Cancer Biology 2021Quote: U2OS cells harboring Doxycycline-inducible human RNF168 were generated using the pINDUCER20 lentiviral vector (Addgene plasmid # 44012; http://n2t.net/addgene:44012; RRID:Addgene_44012). All cell lines were cultured in DMEM medium supplemented with 10% fetal bovine serum and penicillin–streptomycin (1%) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.2 (a1Ha-pcDNA3 was a gift from Dr E. Perez-Reyes, Addgene #45809 (Cribbs et al. 1998), human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... The respective cell lines were subsequently transduced with the human genome-wide CRISPR-KO (GeCKO, Addgene, #1000000048, #1000000049) sgRNA library at a 1000-fold representation and a multiplicity of infection of <0.3 to ensure one sgRNA integration per cell ...