Labshake search
Citations for Addgene :
451 - 500 of 2257 citations for Ephrin type B receptor 1 EphB1 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cancer Biology 2023Quote: Human GBM cells were transduced with the 7TGC (Addgene plasmid #24304), 7TGC-SFRP1 or 7TGC-Notum lentiviral vectors at a multiplicity of infection (MOI ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and firefly luciferase control (FLuc) were generated by subcloning FLuc-5Xbox b from plasmid pAc5.1C-Fluc-STOP-5boxb (Addgene) into pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2019Quote: ... Cas9 guide RNA sequences were identified using the website crispr.mit.edu (guide A: gTCCCCGCAAGAGTAGTAAT; guide B: gGTCTCACAGACCGTAAGTT) and inserted into plasmid pX335 (a gift from Feng Zhang, Addgene, 42335). HeLa Kyoto cells (Landry et al. ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transduced overnight at a MOI of 0.4 with a pooled genome-wide CRISPR KO (GeCKO v2) library A or B (Addgene) containing a total of 122,411 sgRNAs (6 sgRNAs per gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... was designed to target the regions close to the start codon (Figure 1A,B) and the sgRNA sequence was inserted into the pX459 V2.0 plasmid (#62988, Addgene). The reference plasmids containing PA tag sequence were constructed in pBluescript II SK (+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL1R1 sgRNA was custom designed against IL1R1 promoter G-quadruplex (G4-motif B) and cloned in pX333 (Addgene 64073) backbone after replacing Cas9 with mCherry.
-
bioRxiv - Developmental Biology 2020Quote: ... To generate CRISPR Cas9 knockout mESC lines we transfected wild-type (for Srpk1 and Srpk2) or Rlim-/y (for Zfp42) mESCs with pX335 and pKN7 vectors (Addgene) containing gRNA sequences targeting ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... This construct was generated from a plasmid that contained a wild-type (WT) rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293Ts were made to stably express doxycycline(dox)-inducible wild-type muSOX and its catalytically-dead D219A mutant by PCR amplifying the aforementioned coding sequences from Addgene plasmids 131702 and 131704 using the muSOX F/R primers (see Key Resources Table ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HDR donor plasmids carrying wild type me31B gene were constructed by cloning me31B gene DNA into pHD-sfGFP-ScarlessDsRed cloning vector (Addgene) according to suggested protocols ...
-
bioRxiv - Biophysics 2022Quote: The C-terminal 109 residues from wild-type TnsB (termed hereafter as TnsBCTD) was cloned from pXT129_TwinStrep-SUMO-ShTnsB vector (Addgene, #135525) using Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Immunology 2023Quote: DNA inserts containing the coding DNA sequence (CDS) for each wild type gene were generated by restriction digestion previous amplification from plasmids obtained from Addgene (hMX1 ...
-
bioRxiv - Neuroscience 2024Quote: Time-pregnant wild-type C57BL/6J female mice underwent in utero virus injection of CamkII-cre virus (105558-AAV1, Addgene) into the left side of the lateral ventricles ...
-
bioRxiv - Biophysics 2021Quote: Human ACE2 (hACE2) cDNA was obtained from Addgene (#1786; Watertown, MA, USA). To construct an expression plasmid ...
-
bioRxiv - Cancer Biology 2021Quote: The Human CRISPR knockout Pooled Library (GeCKOv2) was purchased from Addgene (#1000000048) and amplified using E ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then infected with human telomerase reverse transcriptase (hTERT)-containing lentivirus (AddGene) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-LC3 (human) plasmid construct was purchased from Addgene (catalog number 24920). All mutant ATG9a ...
-
bioRxiv - Cell Biology 2020Quote: Human SAR1 was subcloned into pLenti-puro (Addgene Cambridge, MA; Plasmid #39481). The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... pcDNA3-HA-human OCRL (gift from Pietro De Camilli, Addgene plasmid # 22207); pCDNA3.0_mitoLAMA-G97 (gift from Kai Johnsson ...
-
bioRxiv - Cell Biology 2019Quote: Human STAMBPL1 was PCR amplified from FLAG-HA-STAMBPL1 (Addgene plasmid #22559), human TBC1 domain containing kinase (TBCK ...
-
bioRxiv - Cancer Biology 2020Quote: The Brunello CRISPR library targeting the human genome was obtained from Addgene (via John Doench and David Root ...
-
bioRxiv - Systems Biology 2021Quote: The human Toronto knockout v3 (TKOv3) genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6 ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Molecular Biology 2021Quote: 144 million Lig4-/- abl pre-B cells were transduced with a viral tet-inducible guide RNA library (Pooled Library #67988, Addgene) containing 90,000 gRNAs targeting over 18,000 mouse genes ...
-
bioRxiv - Bioengineering 2021Quote: ... the U6.3-gRNATraB fragment was PCR amplified from the sgRNATra-B plasmid using primers 2XgRNA-5F and 2XgRNA-6R and was cloned into the sgRNAβTub plasmid (Addgene #112691). To build the TI-pgSITsxl,βTub,Hsp-Cas9 and TI-pgSITTraB,βTub,Hsp-Cas9 constructs (Supplementary Fig ...
-
bioRxiv - Microbiology 2021Quote: The plasmids coding GeCKO sub-libraries A and B were amplified and prepared according to the provided guidelines (Lentiviral Crispr Toolbox, Addgene). 60 million T98G/Cas9 cells were transduced with GeCKO LVs at a MOI of 0,1 to cover about 100-times the half-library complexity ...
-
bioRxiv - Cell Biology 2021Quote: ... and non-targeted Suv420-GFP was achieved by cloning the respective cDNA into Addgene vector CENP-B DBD INCENP GFP (45237, Addgene) at NheI / BamH1 ...
-
bioRxiv - Biochemistry 2023Quote: E.coli codon optimized gBlocks encoding CAHS D and its mutant proteins used in this study were synthesized by (Integrated DNA Technologies) and cloned into pET-28 b (+) vector (Addgene) for bacterial expression ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...