Labshake search
Citations for Addgene :
451 - 500 of 1576 citations for D Iditol 1 13C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of AAV9.hsyn.FLEX.iGluSnFR.WPRE.SV40 (a gift from Loren Looger, Addgene plasmid # 98931 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x x 1013). For sparse expression of GCaMP in the brainstem neurons ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3_SARS2_omicron BA.1 (Addgene plasmid #180375; http://n2t.net/addgene: 180375; RRID:Addgene_180375) and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
bioRxiv - Neuroscience 2023Quote: ... and one of the following helper plasmids: pAAV2/1 (Addgene #112862), pAAV2/2 (Addgene #104963) ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the pLKO.1 lentiviral vector system (Addgene, Cambridge, MA, USA). A list of the stable cell lines generated is summarized in supplementary table S1.
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/Foff-ChRmine-oScarlet (Addgene 137161, 1×1013 titer) was bilaterally injected into either LH (AP ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Biochemistry 2022Quote: DNA constructs for the expression of KRAS4B (1-169) (Addgene #159539) and RAF1 (52-131 ...
-
bioRxiv - Neuroscience 2022Quote: ... for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene, plasmid #100834-AAV1) for calcium imaging were administered directly into the hippocampus ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2retro-syn-jGCaMP7f-WPRE (Addgene 104488, 1 × 1013 GC/ml) [1:1 mixture] ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Neuroscience 2022Quote: ... and 100-200 nl cre-dependent tdTomato (AAV2/1.FLEX.tdTomato.WPRE.SV40, Addgene), and some cases ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Cell Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424 ...
-
bioRxiv - Neuroscience 2023Quote: ... These genomes were packaged in serotype 1 AAV capsids by Addgene (catalog numbers 52473-AAV1 ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was further cloned into pGEX-4T-1 (Addgene) in-frame with the N-terminal GST-tagged fusion construct(21) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PGC-1α cDNA from pcDNA4 myc PGC-1 alpha (Addgene #10974) was cloned into the FUBW backbone driven by a ubiquitin promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000 ng frame selector (pCAS9-mCherry-Frame +0/+1/+2, Addgene plasmid #66939/#66940/#66941 ...
-
bioRxiv - Microbiology 2024Quote: HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid #12263). The pCAGGS HIV-1JRFL gp160 expression plasmid was kindly provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... AAV-PHP.S-tdTomato (Addgene, 59462- PHP.S, titer ≥ 1×10¹³ vg/mL) was utilized ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878 ...
-
bioRxiv - Molecular Biology 2024Quote: ... into a vector derived from the pLKO.1 vector (Addgene #10878) with pre-crRNAs under control of the hU6 promoter and BFP under control of the EF-1α promoter.
-
bioRxiv - Immunology 2024Quote: E2F-1 wt-pGex2TK was a gift from William Kaelin (Addgene plasmid # 21668 ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides for shRNAs were cloned into pLKO.1 vector (Addgene, #21297). The day before transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The target sequences were inserted into a pLKO.1 vector (Addgene). As a negative control an shRNA containing a scramble sequence (ACAAGATGAAGAGCACCA ...
-
bioRxiv - Biophysics 2024Quote: ... the pLKO.1 puro (Addgene; 8453; a gift from Bob Weinberg) backbone was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-M-2×Strep-IRES-Puro(Addgene#141386, Wuhan-Hu-1) with NotI/BamHI- ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-E-2×Strep-IRES-Puro (Addgene#141385, Wuhan-Hu-1), pLVX-M-2×Strep-IRES-Puro(Addgene#141386 ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-retro-EF1a-Cre (Addgene #55636, 1 × 1013 genomic copies (gc)/mL ...
-
bioRxiv - Cancer Biology 2024Quote: The knockdowns were performed using lentiviral plasmid pLKO.1-TRC (Addgene_10878). The plasmid was digested with EcoRI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: Pantothenate kinase 1 (Pank1) plasmids were acquired from Addgene (p. 32871) and expanded in lysogeny broth overnight to an optical density of 0.8 ...
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Bioengineering 2024Quote: ... psPAX2 encoding HIV-1 gag and pol (12260 purchased from Addgene), and pHIV-eGFP encoding eGFP (21373 purchased from Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: pLKO.1 vector was obtained from Addgene (Addgene, Cat No# 10878), deposited graciously by the David Root lab(Moffat et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... the following constructs were used: pLKO.1 (sh ctrl, Addgene, 8453), pLKO.1-TRCN0000147551 (shNFKBIZ ...
-
bioRxiv - Molecular Biology 2021Quote: ... The p-EGFP plasmid (#6077-1) was purchased from Addgene (Watertown, MA); the pEGFP-TSC2 plasmid was created as previously described in (52 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV-mDlx-GFP-Fishell-1 (gift from Gordon Fishell; Addgene plasmid # 83900) was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... MKL-1 Cas9 cell line was developed using pCWCas9 Blast (Addgene #83481) with Blasticidin (10ug/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... HIV-1-GAG fused with EGFP was purchased from Addgene (plasmid 80605). Ezrin plasmid was a generous gift of Adam Kwiatkowski (University of Pittsburgh School of Medicine ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Peter Howley (42) ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Biochemistry 2021Quote: ... TRCN0000047920) and cloned into the lentiviral pLKO.1 vector (Addgene, Watertown, MA) as previously described 56 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...