Labshake search
Citations for Addgene :
451 - 500 of 561 citations for 7 Bromo benzo c isothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... C-terminal FLAG-tagged TMPRSS2 orthologues and the human ΔHDS mutant were ligated into the lentiviral pWPI-BLR vector (Addgene) via restriction digestion or using HiFi Builder (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...
-
bioRxiv - Genomics 2023Quote: ... The W3 terminator was cloned from Cbh_v5 AAV-saCBE C-terminal (a gift from David Liu, Addgene plasmid #137183, RRID:Addgene_137183)22 and inserted at the EcoRI-XhoI multiple cloning site by Gibson assembly ...
-
bioRxiv - Biochemistry 2023Quote: Restriction-free cloning 30 was used to generate the constructs of MglA-link-MglB with C-terminal hexahistidine tag in pHis17-KanR (mglA-link-mglB-H6, refer Addgene plasmid #78201 for vector backbone ...
-
bioRxiv - Bioengineering 2023Quote: The pSECRETS-C plasmids containing desired on-target sequences were constructed via HiFi assembly into the p11.LacY.wtx1 plasmid (Addgene #69056), which was double digested with XbaI and SphI ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... A sgRNA targeting the SYNGAP1 c.1507C site was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). The sgRNA together with the HDR template to introduce the 1507C>T mutation ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... The pCAG-V5-TurboID vector was constructed by inserting the amplified TurboID cDNA containing the V5 epitope (GKPIPNPLLGLDST) sequence at the N-and C-terminal sites into the pCAGGS expression plasmid (Addgene). Expression plasmids encoding V5-TurboID-Solo and Solo-TurboID-V5 were constructed by inserting amplified Solo cDNA with a GS-linker (GGGSx2 ...
-
bioRxiv - Biophysics 2023Quote: ... human SLC26A9 (WT and missense mutants) with a C-terminally attached mTurquoise (mTq2) tag were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequences encoding N-KSR or C-KSR were subcloned into SfiI sites of pSBbi-pur-H-2Kb (# 111623, Addgene, USA) replacing an existing H-2kb fragment ...
-
bioRxiv - Pathology 2024Quote: ... (WT and variants) with a mTurquoise (mTq2) tag on the C-terminus were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Cell Biology 2024Quote: Lentivectors driving HaloTag or TFIIB-Halo expression were generated by amplifying TFIIB and HaloTag for C-terminal insertion by InFusion cloning into EcoRV-digested pLJM1 (Addgene plasmid #19319 ...
-
bioRxiv - Plant Biology 2019Quote: ... K353E, and D450N), RBOHD/C (full-length, C1, C2, and C3) were amplified by PCR and cloned into pOPINK (Addgene, #41143) or pOPINM (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... A C-terminal Strep tag on ORF24-NTD was added by inverse PCR to generate p6H-SUMO3-ORF24-NTD-Strep (Addgene #138467).
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length UL87 was PCR amplified from HCMV Towne BAC DNA with primers to introduced EcoRI and XhoI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138434). Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Cell Biology 2020Quote: ... obtained from Dharmacon) into pUAST vectors containing a C-terminal Venus open reading frame (Wang et. al, 2012, Addgene plasmid 35204). Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233 ...
-
bioRxiv - Cell Biology 2020Quote: ... containing human ATF6 cDNA fused to mCerulean on the C-terminal side of ATF6 was generated by amplifying ATF6 ORF from pEGFP-ATF6 (Addgene #32955) by PCR using the following primers ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... We built plasmids by Gibson assembly for constitutive expression of histones and K27M mutant histones tagged at their C-termini with 2XFLAG epitope tags using the Copia promoter from the plasmid pCoPURO (Addgene 17533), and Drosophila H3 and H3.3 histones from previously published constructs (Ahmad & Henikoff ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids for the FRET-based aggregation reporter were constructed by cloning a fusion of the K18 repeat domain of tau containing the P301L/V337M mutation (20) in frame with C-terminal Clover2 (Addgene #54711) or mRuby2 (Addgene #54768 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Retroviral vectors for JMJD6 expression were generated by cloning the Jmjd6 coding sequence with a C-terminal FLAG-tag sequence (11) into the pBABE plasmid vector containing the neomycin resistance gene (Addgene #1767). Mutant versions of JMJD6 were generated from the wild type construct using QuikChange Lightning site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Plant Biology 2019Quote: ... HR2 was amplified from Col-0 (Fw: GGCTTAAUATGCCTCTTACCGAGATTATCG, Rv: AACCCGAUTTCAAAACGAAGCGAATTC) and mNeon c-terminal tag was amplified from pICSL50015 (Addgene: 50318) (Fw ...
-
bioRxiv - Microbiology 2021Quote: VSV-G–pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene
-
bioRxiv - Biochemistry 2020Quote: ... Monobody HA4 or OptoMB variants were PCR amplified and Gibson-assembled from bacterial plasmids (described above) into a pHR vector with a C-terminal irFP fusion (Addgene #111510). The SH2 domain was amplified from EZ-L664 using PCR ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... codon optimized coding sequences with a C-terminal HA epitope tag were synthesized by IDT and cloned into a pCW57.1 (Addgene plasmid #41393) derived lentiviral vector with a blasticidin resistance gene (replacing the original puromycin resistance gene) ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Microbiology 2020Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the FRET-aggregation reporters were generated by subcloning full length human α-synuclein PCR-amplified from pCAGGS-aSyn-CFP (a gift from Robert Edwards and Ken Nakamura)39 to the C-terminal Clover2 or mRuby2 into the lentiviral expression vector pMK1200 (Addgene #84219)21 under the control of the constitutive EF1A promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19) and cloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138436). Mutations of the RLLLG motif in UL87 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138435). Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19 ...
-
bioRxiv - Cell Biology 2019Quote: SUMO-amphSH3 and GST-amphSH3 were generated by subcloning murine Ampiphysin1 SH3 domain residues 607-686) from pAmph1-mCherry (kind gift from C. Merrifield, Addgene 27692) using BamHI and XhoI restriction sites into a modified pET-SUMO bacterial expression vector (Life Technologies ...
-
bioRxiv - Synthetic Biology 2019Quote: A plasmid for SpCas9 expression (2x NLS and C-terminal His tag, pET-28a) was a gift from the Gao group (Addgene #98158).50 E ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2021Quote: Fragments of Cnn-C-N and Cnn-T-N used in co-IP experiments were amplified from the pDONR-Cnn-C and pDONR-Cnn-T vectors described above by PCR and inserted into a pDEST-HisMBP (Addgene, #11085) vector by Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... cells in BHIS were recovered at 37°C for 1.5-2 hours if using a replicative plasmid (pLI50, a gift from Chia Lee, Addgene plasmid #13573) and at 28°C for 4 hours if using a temperature-sensitive plasmid (pIMAY ...
-
bioRxiv - Microbiology 2019Quote: ... and at 28°C for 4 hours if using a temperature-sensitive plasmid (pIMAY, gift from Tim Foster, Addgene plasmid # 68939) (Lee et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR product containing CHD4 was cloned into a modified pFastBac vector (a gift from S. Gradia, UC Berkeley, vector 438-C, Addgene: 55220) via LIC ...
-
bioRxiv - Developmental Biology 2019Quote: Four gRNAs targeting loci on both sides of the C-terminal region of Rok containing the putative phosphorylation sites to be mutated were cloned into pCFD3 vector (Addgene 49410) following the protocol from (Port et al. ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: hCIB2 was subcloned into pET21a (histidine tag on the C-terminus; hCIB2-6xHis) and GST-Rheb in pGEX-4T-2 (Addgene #15889), transformed in Bl2 (DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR product containing codon optimized nsp12 was cloned into the modified pFastBac vector 438-C (a gift from S. Gradia, UC Berkeley, Addgene: 55220) via LIC ...