Labshake search
Citations for Addgene :
451 - 500 of 1534 citations for 7 Benzothiazolecarboxylicacid 2 3 dihydro 2 thioxo methylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Cell Biology 2020Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ...
-
bioRxiv - Cell Biology 2019Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-DIO-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... together with 2.8 μg of mWasabi-Mito-7 (Addgene #56508) (35 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml, Addgene) viruses were injected with a 10μl Neuros syringe (Hamilton ...
-
bioRxiv - Bioengineering 2022Quote: COS-7 cells were transfected with mEmerald-Sec61b-C1 (Addgene #90992 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Neuroscience 2020Quote: ... sRed2-Mito-7 and pEGFP-LC3 were obtained from Addgene. DsRed-KDEL was created by inserting an ER retention signal sequence (AAGGACGAGCTG ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126 ...
-
bioRxiv - Cell Biology 2021Quote: ... pmCherry-Lifeact-7 (Addgene #54491, gift from Dr. Michael Davidson) and pcDNA3.1-L1CAM (Addgene # 12307 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ...
-
bioRxiv - Developmental Biology 2022Quote: The following plasmids were used: mCherry-EB3-7 (Addgene 55037), Ect2-GFP (Dehapiot et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-2xML1N (#67797) or mNeonGreen-EB3-7 were from Addgene or Allele Biotech ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... or with 2 μg/ml puromycin (Gibco) (pTK93_Lifeact-mCherry; a gift from Iain Cheeseman, Addgene plasmid #46357) for 3 days ...
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... pCAGGS-SARS-CoV-2 S D614G (# 156421) and pcDNA3.1 vectors were obtained from Addgene (Watertown, MA, USA), and Invitrogen (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The pDONR223-PRKCB2 (PKCβII, uniprot identifier: P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...