Labshake search
Citations for Addgene :
451 - 500 of 650 citations for 6 Isoquinolinamine 5 propyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Molecular Biology 2022Quote: ... a sgRNA sequence cutting near MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) was cloned into lentiCRISPR v2 plasmid (Addgene #52961). The Tyrosine to Alanine point mutation was introduced using single-strand Ultramer DNA Oligonucleotide (IDT) ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864; http://n2t.net/addgene:54864; RRID:Addgene_54864) mCherry-Clathrin LC-15 was a gift from Michael Davidson (Addgene plasmid # 55019 ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasmid DNA (5 ng/μl) and Tol2 transposase mRNA(4 ng/μl) (synthesized from pT3TS-Tol2 Addgene #31831) were injected into one-cell stage embryos ...
-
bioRxiv - Genomics 2022Quote: ... 5 μg DNA was incubated with1.75 μg pMD2.G and 3.25 μg pCMV-dR8.91 (Addgene, Watertown, MA; #12259). On the next day ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Plant Biology 2023Quote: ... in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288; Addgene #50269), a C-terminal GR tag (pEPOZ0CM0137 ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 × 106 293T cells were seeded in a 10-cm plate 1 d prior to transfection and co-tranfected with the 3rd generation lentiviral packaging plasmids (5 µg pVSV.G, 3 µg pMDLg/pRRE, and 2.5 µg pRSV-Rev; Addgene # 14888 ...
-
bioRxiv - Genetics 2023Quote: ... and the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897, kind gift from Dr. Peter Varnai) (Tóth et al. ...
-
bioRxiv - Cell Biology 2023Quote: We synthesized gRNAs flanking exon 4 and 5 and cloned them into the gRNA cloning vector (Addgene # 41824) using Gibson assembly (New England Biolabs)[19] ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454) using Lipofectamine 3000 (Invitrogen) ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Transfection control contained 5% pEGFP puro (a gift from Michael McVoy, Addgene plasmid #45561(Abbate et al. 2001)) ...
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ; http://n2t.net/addgene:67944 ; RRID:Addgene_67944). 3xHA-5HT2a plasmid was purchased from cDNA Resource Center ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ LTR of BLV was synthesized and cloned in (pTripCMVGFP) by Genescript.The commercial plasmids Lenti DR8.75 (Addgene #22036) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Neuroscience 2022Quote: ... and 210nl of Arch 3.0- eYFP (rAAV2-EF1a-double floxed-eArch3.0-eYFP; 5 × 1011 GC per ml; UNC Vector Core or eYFP (Addgene plasmid 20296 ...
-
bioRxiv - Cell Biology 2019Quote: ... All gRNA plasmids were generated with primers listed in Supplementary Table 5 (IDT) and integrated into pX330 (Addgene #42230) vector using Zhang Lab General Cloning Protocol 29 ...
-
bioRxiv - Cell Biology 2019Quote: ... and Firefly Luciferase (5’-TGAAGTCTCTGATTAAGTA-3’) were cloned into the HpaI and XhoI restriction sites in pSICOR (Addgene RRID:Addgene_11579) (Ventura et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Genetics 2019Quote: ... Vector pZZ113 containing sgRNA expression cassette against cbr-dpy-5 was derived from PU6∷unc-119_sgRNA (Addgene plasmid # 46169) as described (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: Four mice (experimental group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-ChR2-WPRE-eYFP (Addgene viral prep 20298-AAV5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... This middle entry vector was Gateway recombined using a 5’ entry zebrafish ubiquitious promoter (Addgene #2732, Watertown, MA, USA), a 3’ entry pA vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CasX2 ORF was amplified from pBLO 62.5 (pBLO 62.5 was a gift from Jennifer Doudna and Benjamin Oakes, Addgene plasmid #123124; http://n2t.net/addgene:123124; RRID:Addgene 123124) [39] ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Neuroscience 2023Quote: A volume of 200 nL of pGP-AAV2/5-syn-FLEX-jGCaMP8m-WPRE (1.9×1012 pp/mL, Addgene; #162378) expressing the genetically encoded calcium indicator GcaMP8m was injected into the CA2 region of the right hemisphere at AP -2.0 mm ...
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected the Cre-dependent constructs AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) and AAV-EF1a-DIO-eNpHR3.0-mCherry-WPRE (5×1012 gc/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-expressing BNST neurons were induced to express eYFP (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; Addgene_27056) for visualization of BNST AVP neurons.
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Cancer Biology 2023Quote: ... The top 5 crRNA spacer sequences were selected and cloned into the pX459v2 Cas9 Puro Plasmid (Addgene Plasmid #62988) using single-step golden-gate cloning ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Bioengineering 2019Quote: cDNA for pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #1744856). To generate lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...