Labshake search
Citations for Addgene :
451 - 500 of 2607 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Neuroscience 2024Quote: ... For fiber photometry experiments Fig 4 and 4S: dual virus strategy of AAVretro-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene; 87306-AAVrg; 7×10e12) in PPN and AAVDJ-hEF1a-dFRT-jGCaMP7s(rev)-dFRT-WPRE-hGHp(A ...
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Neuroscience 2024Quote: ... For optogentic activation of the glutamatergic PPN in Figure 3S: AAV5-Ef1a-DIO-hChR2-(E123T/T159C)-eYFP-WPRE was injected into the PPN (Addgene, 35509-AAV5, 4×10e12). For chemogenetic experiments in Figure 4 and 4S ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Biochemistry 2020Quote: pHA#851: osm-10p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139208)
-
bioRxiv - Biochemistry 2020Quote: pHA#853: mec-4p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139210)
-
bioRxiv - Biochemistry 2020Quote: pHA#850: osm-10p∷FynY531F∷unc-54 3’UTR (Addgene ID: 139207)
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The pRPC-oscillator plasmid is based on pZS1-lTlrLLtCL [3] (Addgene #26489) with the dCas9 gene taken from pdCas9-bacteria [18] (Addgene #44249) ...
-
bioRxiv - Immunology 2021Quote: ... EMTP-3×GFP was a gift from William Bement (Addgene plasmid # 26741). Histone 2B-GFP was a gift from Geoff Wahl (Addgene plasmid # 11680) ...
-
bioRxiv - Cell Biology 2023Quote: ... an Fmr1 exon 3 DNA oligonucleotide was inserted into pLentiCRISPR (Addgene, 49535) adapted from published methods [12] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Isoform 3 constructs were cloned into a pMSCV puro backbone (Addgene) and packaged into retrovirus using Phoenix-AMPHO producer cells (ATCC) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 μg of episomal pCXLE-Sox2A61V-2A-Klf4-2A-Myc (Addgene #210017) and 3 μg of pCXWB-EBNA1 (Addgene #37624 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542 ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Cancer Biology 2023Quote: PC-3 cells were transfected with Emerin-pEGFP-C1 (Addgene plasmid #61993). Forty-eight hours post-transfection cells were cultured in medium containing G-418 (400Lμg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 3) pMXs-IP-EGFP-mATG5 was a gift from Noboru Mizushima (Addgene plasmid #38196 ...
-
bioRxiv - Cell Biology 2022Quote: ptf-Galectin-3 was a gift from Tamotsu Yoshimori (Addgene plasmid # 64149) (Maejima et al. ...
-
bioRxiv - Genetics 2022Quote: ... 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449), 80 ng/ul Of-v gRNA described above (see “CRISPR/Cas9 mutagenesis of Of-vermilion”) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-EGFP (1μL per site, titer ≥ 3 ×1012 vg/mL, Addgene) was injected bilaterally in the dHP ...
-
bioRxiv - Cell Biology 2024Quote: ... co-injection marker pCFJ104 (Pmyo-3-mCherry; Addgene #19328, 5 ng/µL) and marker pCFJ90 (Pmyo-2-mCherry ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...