Labshake search
Citations for Addgene :
451 - 500 of 1553 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259). Medium was changed 16 h after transfection and lentiviral particles were harvested 24 h later ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Systems Biology 2024Quote: ... each promoter was transferred to the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904), pBS-KS-attB2-SA(0)-T2A-VP16AD-Hsp70 (Addgene #62905) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260) using Jet Pei reagent (Polyplus ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... plasmids pTwist-SARS-CoV-2 d18 B.1.617.2v1 (Addgene #179905) and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907 ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907) were kindly shared by Dr ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV-flex-GCaMP6f (Addgene #100833, 2 × 1013 gc/mL) was injected into the PL ...
-
bioRxiv - Bioengineering 2024Quote: ... derived from Prime editor 2 system (PE2, Addgene plasmid #132775) 15 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and WPMY cells were overexpressed with Wnt-2 (Addgene 43809). All flag plasmids were manufactured by Gene Universal ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... Jurkat T cells were transfected with mTurquoise-Farnesyl-5 plasmid (#55551, Addgene) 24 hours prior to the assay ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry was PCR amplified from mCherry-Alpha-5-Integrin-12 (Addgene #54970) using forward primer 54970RMmCherryaddNHis_F2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Developmental Biology 2020Quote: ... Bot oligo – 5’ aaacGGGTGAGACCCATGTATTTc3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg of PMD2.G envelope– expressing plasmids (no. 12259, Addgene) were diluted in 500 μl of jetPRIME buffer (no ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 or AAV9.syn.GCaMP8s-WPRE virus (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre animals injected with AAV2/5.EF1a.Dio.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... tFucci(CA)5 was a gift from Atsushi Miyawaki (Addgene plasmid # 153521).
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... top 5 sgRNAs/gene library was gift from Jonathan Weissman (Addgene #83969) (20) ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5 ...
-
bioRxiv - Cell Biology 2024Quote: ... co-injection marker pCFJ104 (Pmyo-3-mCherry; Addgene #19328, 5 ng/µL) and marker pCFJ90 (Pmyo-2-mCherry ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077; http://n2t.net/addgene:27077;RRID:Addgene_27077) [pCXLE-hUL ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Cell Biology 2020Quote: HA-NFAT1(4-460)-GFP was a gift from Anjana Rao (Addgene plasmid # 11107). Patterned cells expressing NFAT-GFP was imaged using Zeiss LSM 880 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Molecular Biology 2021Quote: ... (2) LwaCas13a coding sequence and Shine-Dalgarno sequence amplified from Addgene #91865 using primers oAM1496 and oAM1497 ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Biochemistry 2021Quote: ... we co-transformed plasmids SARS-CoV-2 nsp10 (Addgene ID 169158) and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159) ...
-
bioRxiv - Biophysics 2021Quote: ... the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710). After 48 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for biosensors were purchased from Addgene (see Supplementary Table 2). ERKKTR ...
-
bioRxiv - Cell Biology 2021Quote: ... and the three injection markers pCFJ90 (Pmyo-2::mCherry, Addgene #19327), pCFJ104 (Pmyo-3::mCherry ...