Labshake search
Citations for Addgene :
451 - 500 of 1661 citations for 4' Bromo 3' fluoro 2 morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and AAV2.CAG.tdTomato (Addgene, #59462-AAV2, titer: 4×10¹² vg/mL) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425 ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Microbiology 2022Quote: pCMV-GFP-SARS-CoV-ORF3a was generated by recombining the SARS-CoV-2-ORF3a coding sequence (pDONR207 SARS-CoV-2 ORF3aA, #141271, Addgene) into pDEST-CMV-N-EGFP (#122842 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Microbiology 2022Quote: UAS-SARS-CoV-2-ORF3a transgenic flies were generated by PCR-mediated subcloning of the SARS-CoV-2-ORF3a coding sequence (pDONR207-SARS-CoV-2 ORF3a, #141271, Addgene) into pUASt-Attb (EcoRI/XbaI) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Microbiology 2024Quote: The following open reading frames were cloned into an expression vector under the control of the phosphoglycerate kinase promoter: IKK-2 and its mutant IKK-2 K44M (Addgene plasmids #11103 and #11104 ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... and pmNG-Mpro-NLuc-PLpro-mScarlet either alone or co-transfected with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with DuProSense biosensor containing Mpro cleavage sites and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid along with pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gRNAs 1 and 2 (Supplemental Table 2) were cloned into the pSpCas9n(BB)-2A-Puro (PX462) V2.0 plasmid (Addgene 62987) as described previously70 ...
-
bioRxiv - Biophysics 2024Quote: ... equal amounts of both pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) vector was then inserted into the pX330A-1x2-cNAT10 vector using Golden Gate Assembly (New England Biolab ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD.2 (Didier Trono, Addgene plasmid # 12259), combined with either Cas9 expression vector plenti-Cas9-blast (Feng Zhang ...
-
bioRxiv - Molecular Biology 2023Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) was cut-out via Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Plant Biology 2023Quote: ... the AtCas9 (2×35S::AtCAS9-OCST; Addgene #112079) and the linker pICH41780 (Addgene #48019 ...
-
bioRxiv - Biophysics 2023Quote: The plasmid pr8ΔEnv.2 was obtained from Addgene, Plasmid #12263) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg of tdTomato-Mito-7 (Addgene_#58115) (Ai et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... into a level 2 binary vector (Addgene #54346). LRR12-19VvFLS2 fragments carrying computationally predicted polymorphic residue sets (‘comp.Max’ ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 Y213A/I216A/W276A/I279A (ΔLIR1+2) (RRID:Addgene_223752), BCL2L13 I224A/L227A/W276A/I279A (ΔLIR1+3 ...
-
bioRxiv - Bioengineering 2024Quote: ... and Prime editor 2 (herein called PE2) (Addgene plasmids ...
-
bioRxiv - Bioengineering 2024Quote: ... or pAAV 2/9n for AAV9 (Addgene #112865). Calcium phosphate-based transfection was carried out26 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of N gene with the natural codon usage of SARS-CoV-2 from pSARS-CoV-2 (N) plasmid (Addgene #153201) was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 using the same enzymes.
-
bioRxiv - Cell Biology 2024Quote: ... Dynamin-2-EGFP was generated in this study by exchanging Dynamin-2 from Dyn2-pmCherry N1 (purchased from Addgene mentioned above) with EGFP from pEGFP-N1 using EcoRI and NheI restriction digestion-based cloning.
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...