Labshake search
Citations for Addgene :
451 - 500 of 736 citations for 3 Trifluoromethylthio benzeneboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The construct for E.coli expression of WT caspase-3 (pET23b-Casp3-His) was obtained from Addgene (plasmid 11821). The construct for mammalian expression of caspase-3/GFP was a gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... The lin-3 guide sequence was inserted into pDD162 (eef-1A.1p::Cas9 + empty sgRNA, Addgene plasmid #47549) using Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276; http://n2t.net/addgene:73276 ; RRID:Addgene_73276) General yeast manipulation ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Microbiology 2024Quote: ... The 5’ p230p and 3’ p230p targeting sequences were cloned into the pPbU6-hdhfr/yfcu plasmid (Addgene #216422),44 carrying the dual positive and negative selection marker hdhfr-yfcu (human dihydrofolate reductase/yeast cytosine deaminase and uridyl phosphoribosyl transferase ...
-
bioRxiv - Neuroscience 2024Quote: ... an oligonucleotide pair (Supplemental Table 3) was annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410) as described (Port et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... groups of 3-4 pups were separated from their mother and 6 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR and products were cloned into NheI and EcoRV restriction sites (Table 3: marked with blue) of pcDNA3.1-hygro vector (Addgene, kindly provided by Mark Richards-Bayliss group ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2021Quote: ... we performed 80 co-transfections of HeK293T virus packaging cells (at approximatelly 60-70% confluence on 10 cm dishes) with 3 μg of the pDECKO_mCherry plasmid library and 2.25 μg of the packaging plasmid pVsVg (Addgene 8484) and 750 ng of psPAX2 (Addgene 12260 ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Immunology 2022Quote: ... and mSGK3 exon 3 (TTCAAGACATTAAATGCAG) were designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and cloned into TLCV2 (Addgene plasmid # 87360,) as described previously5455 ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.7 μg pLenti6.3-HA-NL-tetraspanin plasmids or pLenti6.3-CD63-pHluorin plasmid were co-transfected with 0.9 μg pREV (Addgene, 12253) and 1.8 μg pRRE (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was injected into worms along with a plasmid containing transposase (pCFJ601, Peft-3::Mos1 transposase, Addgene #34874) and co-injection markers (pGH8 Addgene #19359 ...
-
bioRxiv - Genetics 2023Quote: ... and a 3’ UTR harboring the WPRE element was cloned in the pT7-PEmax for IVT plasmid (Addgene 178113)2 ...
-
bioRxiv - Neuroscience 2024Quote: ... P1-3 pups were injected with 360 nL of AAV1-FLEX-tdTomato (titer: 2.5×1013 vg/mL, Addgene #28306) per cortical hemisphere ...
-
bioRxiv - Molecular Biology 2024Quote: ... and subsequently fused in-frame with the GFP reporter gene with unc-54 3′UTR which was amplified from pPD95.75 plasmid (Addgene) using GFP_C and GFP_D primers (Table S1) ...
-
bioRxiv - Plant Biology 2024Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Neuroscience 2024Quote: ... NTC-R aaactaaaccaggtgcctcagccgc-3′) were then annealed and cloned into the BsmBI cloning site of lentiGuide-puro (Addgene #52963) plasmid that contains a U6 promoter driving the expression of the specific P2ry13 or NTC gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Supplementary Table 3) were individually inserted downstream of the U6 promoters in the corresponding plasmids: pMJ114 (bovine U6; RRID:Addgene_85995), pMJ179 (mouse U6 ...