Labshake search
Citations for Addgene :
451 - 500 of 1989 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Neuroscience 2021Quote: ... FL: 24.5 μl of AAV9-hSyn-ChR2-eYFP (UPenn Lot: CS0964 based on Addgene 26973P, titer: 1.03e13 GC/ml). The construct was loaded into a 10 μl Nanofil syringe (World Precision Instruments ...
-
bioRxiv - Biochemistry 2021Quote: Expression plasmids for CjCBM5 (residue 251-309) and CjCBM73 (residue 338-397) based on the pNIC-CH vector (Addgene) were used for cytoplasmic expression as previously described (20) ...
-
bioRxiv - Neuroscience 2020Quote: ... The homology templates for Gr23 and Gr24 were constructed based on a pHD-DsRed vector (a gift from Kate O’Connor-Giles; Addgene plasmid #51434 ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids expressing sgRNAs were made by cloning the annealed oligo sgRNA sequences into PX459-based vector (Addgene plasmid #62988). The oligo sequences for sg-NBRE-1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pcDNA3-based plasmids encoding FLAG-tagged wild type and SATA (S939A/T1462A)-mutant TSC2(51) were obtained from Addgene. The TSC2-5A (S939A ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Optimal magnesium concentration was determined to be 8 mM based on expression of the plasmid pJL1-sfGFP (Addgene #69496) encoding superfolder Green Fluorescent Protein (sfGFP).
-
bioRxiv - Neuroscience 2020Quote: ... CMV-Td-Tomato-encoding lentivirus (1.5×1010 TU/mL, produced at the University of North Carolina Vector Core Facility based on plasmid # 30530, Addgene, kindly provided by Dr ...
-
bioRxiv - Genetics 2020Quote: sgRNAs were designed using a web-based CRISPR design tool and cloned into lentiCRISPR (Addgene Plasmid 49535 and 52961) original or modified to create the VQR mutation ...
-
bioRxiv - Neuroscience 2022Quote: Lentiviral vectors were based on FUGW (FUGW was a gift from David Baltimore [Addgene plasmid # 14883; http://n2t.net/addgene:14883; RRID: Addgene_14883]) (Lois et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral BFP-KDEL plasmid (pHAGE2-EF1a-BFP-KDEL-IRES-Hygro) was based on BFP-KDEL (Addgene Plasmid #49150). Frataxin plasmid (pCMV6-FXN-Myc-FLAG ...
-
bioRxiv - Neuroscience 2023Quote: ... The genetic construct of zebrafish plasmid is based on the vector pDEST-Tol2-PA2-CMV-AB-mCh (Addgene, #160435) [55] in which the Abeta peptide was exchanged to EGFP-polyQ94 from pcDNA3.1-EGFP-polyQ94 ...
-
bioRxiv - Molecular Biology 2023Quote: WT and mutant firefly luciferase reporters were made based on the backbone plasmid purchased from Addgene (https://www.addgene.org/114670/). PCR amplified the 5’ UTR DNA fragments from cDNA prepared from HEK293T or AC16 human CM cell line using primers with the extra 5’ end corresponding to the BsmbI cut sites in the plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... a plasmid previously used in Clostridium difficile that contains an aTc- inducible transposase and mariner-based transposon (Addgene 106377) 48 ...
-
bioRxiv - Bioengineering 2024Quote: oROS-HT variants were all cloned based on the pC1 plasmid backbone from pC1-HyPer-Red (Addgene ID: 48249). Primers for point mutations or fragment assembly required to generate the oROS-HT screening variants were designed for In Vitro Assembly cloning (IVA ...
-
bioRxiv - Genomics 2023Quote: ... The screening vector was based on a lentiviral vector pRRLSIN.cPPT.PGK-GFP.WPRE (a gift from Didier Trono; Addgene plasmid # 12252), in which an enhancer blocker and barrier insulator element C114 was introduced 36 bp into the proximal portion of the 3′ LTR ...
-
bioRxiv - Cancer Biology 2024Quote: DIV06 rat cortical neurons were infected with AAV5 virus based on the AAV-Flex-TACasp3-TEVP plasmid (Addgene #45580)83 at a titer of >7x108 vg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Neuroscience 2021Quote: ... and the control virus AAV2/5-hGFAP-EGFP-5’miR-30a-shRNA(scramble)-3’miR-30a-WPREs (AAV-shscramble, 2.57 × 1012 vg/mL) were synthesized based on the pAAV-hGFAP-EGFP-WPRE-hGH plasmid (Addgene # 105549) and packaged by Brain VTA (Wuhan ...
-
bioRxiv - Cell Biology 2022Quote: The GFP-P2A-FLAG-K(AAA)20-P2A-mKate2 construct was modified based on GFP-P2A-FLAG-K(AAG)20-P2A-RFP (105689, Addgene). For MTS (Mitochondrial targeting sequence)- GFP-K(AAA)20-P2A-mKate2 construction ...
-
bioRxiv - Cell Biology 2022Quote: ... was generated by synthesizing (Genewiz) a sequence containing three copies of mCherry (based on the sequence from pHAGE-EFS-N22p-3XRFPnls; plasmid #75387; Addgene); the sequences encoding the mAID and SMASh degrons (from38) ...
-
bioRxiv - Biochemistry 2019Quote: ... we selected a BRD2-expressing stable ARPE19 cell line using a lentivector constructed based on an empty vector (Addgene, 19319).
-
bioRxiv - Cancer Biology 2019Quote: ... Guides targeting p53 CDE+ and CDE− genes were synthesized as pools using array-based synthesis and cloned in the Lentiguide puro vector (Addgene plasmid 52963 – kind gift from Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... which provided a higher titer (AAV5-hSyn-ChR2-eYFP, UPenn Lot: CS1078 based on Addgene 26973P, titer: 3.828e13 GC/ml). All injections were made in five different locations in a plus-shaped pattern within the chamber and separated by 2 mm horizontally and vertically (see example in Supp ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2020Quote: ... a TRIL-based miRNA construct was constructed by modifying the Cre-dependent AAV-FLEX-EGFP-mir30 (Scn9a) (Addgene plasmid # 79672) (43 ...
-
bioRxiv - Neuroscience 2020Quote: ... RFP-GFP-LC3-encoding retrovirus (9.3×10 TU/mL, produced at the Molecular Tools Platform at the CERVO Brain Research Center based on plasmid #21074, Addgene, kindly provided by Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... CMV-PercevalHR (1×1010 TU/mL, produced at the University of North Carolina Vector Core Facility based on plasmid # 49083, Addgene, kindly provided by Dr ...
-
bioRxiv - Genomics 2021Quote: The lentiviral dCas9 expression plasmid (lenti-dCas9-Blast) was generated by PCR-based mutagenesis of lentiCas9-Blast plasmid (Addgene #52962). Clover fused with PUF RNA-binding domain were previously described ...
-
bioRxiv - Immunology 2021Quote: The Extracellular domain of SARS-CoV-2 spike protein of that (GenBank: MN908947) was engineered in a pcDNA3CMV-based-plasmid as Zhou-COVID-19-Spike (Plasmid #161029, Addgene) to assemble pseudo-virus more efficiently ...