-
No products found
because this supplier's products are not listed.
Kinga Szydłowska, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Primers used were: rno-miR-155-5p (RT:002571, ThermoFisher Scientific), and rno-miR-674-3p (RT:001956 ...
-
No products found
because this supplier's products are not listed.
Michiko O. Inouye, et al.,
bioRxiv - Neuroscience 2022
Quote:
... miR-329 pLNA (miRCURY LNA miRNA Power Inhibitor RNO-MIR-329-3P, Qiagen # 339130 YI04101481-DCA), miR-495 pLNA (miRCURY LNA miRNA Power Inhibitor HSA-MIR-495-3P ...
-
No products found
because this supplier's products are not listed.
Mariska Miranda, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Standard RT-PCR using independent sets of Predesigned KiCqStart® SYBR® Green Primers (Sigma, Table S11) was carried out for validation with independent biological replicates from 2D cultures (n = 2 ...
-
No products found
because this supplier's products are not listed.
Amit Prabhakar, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... qRT-PCR reactions were performed using pre-miR-primers by real-time PCR machine (CFX96, BioRad). 100 U/ml RNase inhibitor (SUPERase•in™ ...
-
No products found
because this supplier's products are not listed.
Nikita Vasilyev, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
No products found
because this supplier's products are not listed.
Yasuo Ariumi,
bioRxiv - Microbiology 2021
Quote:
... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
No products found
because this supplier's products are not listed.
Yi-Chen Chen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2) and Index PCR Primers mentioned in the manufacturer’s instructions (Illumina, USA). After gel purification ...
-
No products found
because this supplier's products are not listed.
Anna Tejchman-Skrzyszewska, et al.,
bioRxiv - Neuroscience 2023
Quote:
... RT-PCR with random primers (Promega, Madison, WI, USA) and Moloney murine leukemia virus M-MLV reverse transcriptase (Promega ...
-
No products found
because this supplier's products are not listed.
Kasper Mikkelsen, et al.,
bioRxiv - Microbiology 2023
Quote:
... RT-PCR reactions were set up using the FastStart Essential DNA Green Master kit (Roche), using four different primer pairs ...
-
No products found
because this supplier's products are not listed.
Bonita H. Powell, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... TaqMan miRNA stem-loop RT primers/qPCR primer probe sets (ABI 4427975) (cel-miR-39 ID# 000200 Lot#P180110-003B10 ...
-
No products found
because this supplier's products are not listed.
Baojun Ren, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Mycoplasma Plus PCR Primer Set (Agilent) was used to determine mycoplasma for all cell lines ...
-
No products found
because this supplier's products are not listed.
Michael J. Podolsky, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Quantitative real-time PCR reactions were performed with different sets of primers and Sensifast SYBR (Bioline, Taunton, MA) on a CFX96 or CFX384 Real-Time PCR Detection System (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Sicong Ma, Samantha A. Howden, Sarah C. Keane,
bioRxiv - Biochemistry 2024
Quote:
... GG-pre-miR-19a and pre-miR-143 were generated by overlap-extension (OE) polymerase chain reaction (PCR) using EconoTaq PLUS 2x Master Mix (Lucigen) with primers listed in Table S1 ...
-
No products found
because this supplier's products are not listed.
Grant F Marshall, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
No products found
because this supplier's products are not listed.
Sean O’Connor, et al.,
bioRxiv - Cell Biology 2020
Quote:
... primary miRNAs for miR-29a and miR-16 were amplified from genomic DNA by PCR and cloned into the pAdTrack shuttle (Addgene, Plasmid#16404). The miR-16 pAdTrack plasmid was then mutated by site-directed mutagenesis to induce 3 point mutations into the miR-16 seed sequence ...
-
No products found
because this supplier's products are not listed.
Karine Pozo, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 E7335S, Index Primers Set 2, E7500S) with Agencourt AMPure XP magnetic beads (Beckman coulter A63881) exactly as per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kaneez Fatima, et al.,
bioRxiv - Cell Biology 2024
Quote:
... TransIT-X2 (MirusBio, MIR 6000) or TransIT2020 (Mirus, MIR 5400) were used for cell transfection according to manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Leonardo Lupori, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The primer sets used were Quick-16S™ Primer Set V3-V4 (Zymo Research). The sequencing library was prepared using an innovative library preparation process in which PCR reactions were performed in real-time PCR machines to control cycles and therefore limit PCR chimera formation ...
-
No products found
because this supplier's products are not listed.
Wei Yu, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Mouse positive control primer set Actb2 (#71017, Active Motif) and mouse negative control primer set 1 (#71011 ...
-
No products found
because this supplier's products are not listed.
Cilia R Pothast, et al.,
bioRxiv - Immunology 2022
Quote:
... Smartseq2modified PCR primer (Eurogentec) and TRAC or TRBC1/2 specific primers (Eurogentec ...
-
No products found
because this supplier's products are not listed.
Alexandr Samocha, et al.,
bioRxiv - Cell Biology 2020
Quote:
... RT PCR was performed using the RealPlex2 (Eppendorf). Expression was normalized to ß-Actin (Mm02619580_g1 ...
-
No products found
because this supplier's products are not listed.
Yumei Qin, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Genotypes were confirmed using primer sets recommended by Jackson Laboratory and Sinha lab.
-
No products found
because this supplier's products are not listed.
Shubhangini Tiwari, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The cDNA was obtained by RT-PCR and amplified through PCR using respective primers (OriGene Technologies) followed by agarose gel electrophoresis to assess the gene expression ...
-
No products found
because this supplier's products are not listed.
Coralie Dessauges, et al.,
bioRxiv - Systems Biology 2022
Quote:
... The following primers were used for the RT-qPCR reaction (designed with the Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript).
-
No products found
because this supplier's products are not listed.
Katarzyna Goljanek-Whysall, et al.,
bioRxiv - Physiology 2019
Quote:
... with 100nM miR scrambled or miR-181a mimic (100nM; GE Healthcare) (Soriano-Arroquia et al. ...
-
No products found
because this supplier's products are not listed.
Pastor Jullian Fabres, et al.,
bioRxiv - Plant Biology 2021
Quote:
... RT-PCR products were purified using PCR Clean-up (Macherey-Nagel, 740609.250) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Astrid Hoermann, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... RT-PCR was performed with RedTaq Polymerase (VWR) with primers 51-Scorpine-F and 117-CP-ctrl-R on Sco-CP (1267bp) ...
-
No products found
because this supplier's products are not listed.
Peter F. Renz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 12 μl Bead RT/PCR Enhancer reagent from BD Biosciences and 72 μl nuclease free water for a total volume of 200 μl ...
-
No products found
because this supplier's products are not listed.
Christophe M. Capelle, et al.,
bioRxiv - Immunology 2021
Quote:
... the cells were fixed for 1 h at RT using the True-Nuclear transcription Factor Buffer Set (BioLegend, 424401). Following the fixation ...
-
No products found
Sean Manning, et al.,
bioRxiv - Genomics 2021
Quote:
... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
No products found
because this supplier's products are not listed.
Connor G. G. Bamford, et al.,
bioRxiv - Microbiology 2021
Quote:
... these were run as two separate multiplex PCR “pools” (A & B) using the ARTIC version 3 primer set (ARTIC nCoV-2019 V3 Panel, IDT DNA Inc ...
-
No products found
because this supplier's products are not listed.
Ekaterina S. Potekhina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... OneTube RT-PCR SYBR kit (Evrogen) was used for cDNA production by reverse transcription followed by qPCR ...
-
No products found
because this supplier's products are not listed.
Zhihua Liu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Reverse transcription with ZIKA virus specific primer (Rev-AAGTGATCCATGTGATCAGTTGATCC) was performed using FastQuant RT Kit (Tiangen). Real-time PCR was done on 7900HT (ABI ...
-
No products found
because this supplier's products are not listed.
Matthew D. Cain, et al.,
bioRxiv - Immunology 2023
Quote:
... rabbit anti-GAP43 (Novus Biologicals, NB300-143). Images were acquired using a Zeiss LSM 880 confocal laser scanning microscope and processed using Zen3.3 (Zeiss ...
-
No products found
because this supplier's products are not listed.
Krisztina Percze, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 130 of the colonies were analysed by colony PCR (using an M13 primer set, Table S1) and capillary electrophoresis (LabChip GX, PerkinElmer) using the DNA 1K Reagent Kit with DNA HT 5K LabChip single sipper chip ...
-
No products found
because this supplier's products are not listed.
Leelavathi N Madhu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The qRT-PCR was performed using RT² SYBR Green qPCR Mastermix and Primer mix (GeneCopoeia, Rockville, Maryland, USA) for measuring human microglial gene expression in iMicroglia (tmem119 ...
-
No products found
because this supplier's products are not listed.
Clay Conner, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... the cells were incubated with DAPI diluted in PBS for 10 min at RT and washed before being mounted onto slides with Vectashield Hard Set (Vector Laboratories). Single-planed images were taken on a Nikon C2 confocal microscope using a 40X oil-immersion lens ...
-
No products found
because this supplier's products are not listed.
Linda S. Rubio, Suman Mohajan, David S. Gross,
bioRxiv - Genetics 2023
Quote:
... Filter set 89021 (Chroma Technology) and a Photometrics Prime 95B camera were used to image GFP and mCherry ...
-
No products found
because this supplier's products are not listed.
Peng Wang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and phosphatase inhibitor cocktail set III (Calbiochem). Protein was quantified with Pierce BCA protein assay kit (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Yapeng Su, et al.,
bioRxiv - Bioengineering 2019
Quote:
... MART1and PFK transcripts were analyzed by SYBR Green–based real-time quantitative RT-PCR (qRT-PCR) using specific primers purchased from Santa Cruz. Data were normalized to the expression of RPL19 and are expressed as fold changes.
-
No products found
because this supplier's products are not listed.
Justin X. Boeckman, et al.,
bioRxiv - Pathology 2021
Quote:
... Positive bands of appropriate size were confirmed using individual primer sets and resultant PCR products were visualized on a 1.5% agarose gel with gel red (Biotium).
-
No products found
because this supplier's products are not listed.
Erick X. Pérez-Guzmán, et al.,
bioRxiv - Microbiology 2019
Quote:
... and using DENV RT primer/probe Mix kit (Genesig, Primerdesign Ltd., UK) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Xiaoding Hu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Recombinant human decorin protein (#143-DE-100) was purchased from R&D Systems (USA). Anti-decorin (#HPA064736) ...
-
No products found
because this supplier's products are not listed.
Teketel A. Haile, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Two allele specific forward primers and a reverse primer were designed for use in fluorescence based competitive allele-specific PCR assays (KASP; LGC Biosearch Technologies). DNA from the 286 lines was assayed using these primers and KASP reaction mix (LGC Biosearch Technologies ...
-
No products found
because this supplier's products are not listed.
Tomonari Nozaki, Shuji Shigenobu,
bioRxiv - Zoology 2021
Quote:
... Aphid bacteriomes were dissected in phosphate-buffered saline (PBS: 33 mM 143 KH2PO4, 33 mM Na2HPO4, pH 6.8) under a stereomicroscope (SZ61, Olympus, Japan), with fine forceps ...
-
No products found
because this supplier's products are not listed.
Felix J. Flomm, et al.,
bioRxiv - Microbiology 2022
Quote:
... and corresponding filter sets (Nikon). Imaging conditions were optimized for each sample ...
-
No products found
because this supplier's products are not listed.
Aleksandr Alekseev, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Filter set 10 (Carl Zeiss) was used for separating the fluorescence and the excitation light ...
-
No products found
because this supplier's products are not listed.
Wataru Yamamoto, Rafael Yuste,
bioRxiv - Neuroscience 2019
Quote:
... equipped with a long-pass GFP filter set (Leica filter set ET GFP M205FA/M165FC), 1.63X Plan Apo objective ...
-
No products found
because this supplier's products are not listed.
Max S. Farnworth, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Cy5 goat anti-Rat (#112–175-143; Jackson Immunoresearch, West Grove,PA), used at 1:400 for DN-Cadherin) ...
-
No products found
because this supplier's products are not listed.
Leonardo Augusto, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cloned IRE1-/- MEF cells were validated by RT-qPCR using specific primers and by immunoblot using IRE1-specific antibody (Abcam-ab37073). IRE1-/- cells were complemented with pcDNA3-derived vectors containing WT or the indicated mutant versions of IRE1 ...