-
No products found
because this supplier's products are not listed.
Ilia Zhernov, et al.,
bioRxiv - Biophysics 2020
Quote:
... Samples were excited using LU-N4/N4S laser unit (Nikon). Illumination and image acquisition was controlled by NIS Elements Advanced Research software (Nikon) ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 5: Nε-benzoyl-L-lysine (LysZ, Sigma-Aldrich); 6 ...
-
No products found
because this supplier's products are not listed.
Ya Guan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Benzoyl peroxide (BPO, Thermo Fisher Scientific), acryloyl chloride ...
-
No products found
because this supplier's products are not listed.
Síle A. Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
... CD11c (clone N4/18, Biolegend), F4/80 (clone BM8 ...
-
No products found
because this supplier's products are not listed.
Fadilah Fadilah, et al.,
bioRxiv - Biochemistry 2020
Quote:
... benzoyl chloride p.a (Merck), K2CO3 p.a (Merck) ...
-
No products found
because this supplier's products are not listed.
James Walker, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... PCR product synthesized with N4-methyl-dCTP (4mdCTP; Trilink) using primers JZ294/JZ295 (Table S5 ...
-
No products found
because this supplier's products are not listed.
Ariane C. Boehm, et al.,
bioRxiv - Neuroscience 2022
Quote:
... benzoyl chloride (VWR, Darmstadt, Germany), [2H4]-histamine ...
-
No products found
because this supplier's products are not listed.
Matthew A. Schaller, et al.,
bioRxiv - Microbiology 2021
Quote:
... the following drugs were used: β-d-N4-hydroxycytidine (9002958; Cayman Chemical), chloroquine (C6628 ...
-
No products found
because this supplier's products are not listed.
Anika Shimonty, et al.,
bioRxiv - Physiology 2024
Quote:
... and 0.7% benzoyl peroxide (Polysciences, Inc., Warrington, PA)/acetone until infiltration was complete ...
-
No products found
because this supplier's products are not listed.
Sumera Perveen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
No products found
because this supplier's products are not listed.
R. G. Langston, et al.,
bioRxiv - Neuroscience 2021
Quote:
... coated plates in N4 media (N3 with 0.05uM Retinoic acid, 2ng/ml BDNF (R&D Systems #248-BDB) and 2 ng/ul GDNF (R&D Systems #212-GD)) ...
-
No products found
because this supplier's products are not listed.
Buki Kwon, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
No products found
because this supplier's products are not listed.
Komi Gbedande, et al.,
bioRxiv - Immunology 2023
Quote:
... Recipient Thy1.1 BALB/cByJ were backcrossed to BALB/cJ (N4; The Jackson Laboratory, Bar Harbor, ME). B5 T cell receptor transgenic (TCR Tg) ...
-
No products found
because this supplier's products are not listed.
W H Lee, W Liu, J Fan, D Yang,
bioRxiv - Biophysics 2020
Quote:
... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
No products found
because this supplier's products are not listed.
Guilherme S. Hentschke, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
No products found
because this supplier's products are not listed.
Shawna K. Brookens, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ng/mL IL-5 (Peprotech), and 50 nM 4-hydroxy-tamoxifen (4-OHT ...
-
No products found
because this supplier's products are not listed.
Peng Wang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5-Iodotubercidin (5-IT) (1745, Tocris), Recombinant human TNF-α (210-TA-010 ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
No products found
because this supplier's products are not listed.
Blake A. Caldwell, Yajun Wu, Jing Wang, Liwu Li,
bioRxiv - Immunology 2023
Quote:
... For 5-azacytidine (5-aza; Stem Cell Technologies) and trehalose 6,6’-dimycolate (TDM ...
-
No products found
because this supplier's products are not listed.
Matthew L Turnbull, et al.,
bioRxiv - Microbiology 2024
Quote:
... anti-Paired box protein-5 (Pax-5; Abcam). To detect Mx-1 ...
-
No products found
because this supplier's products are not listed.
Maria L. White, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 (BioTek). OD600nm readings were taken every hour and growth curves were plotted using GraphPad Prism 9.
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Jihyun Yu, et al.,
bioRxiv - Immunology 2024
Quote:
... IL-5: anti-mouse IL-5 (TRFK5, BD Biosciences), biotinylated anti-mouse IL-5 (TRFK4 ...
-
No products found
because this supplier's products are not listed.
Aidan C. Daly, et al.,
bioRxiv - Systems Biology 2024
Quote:
... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
No products found
because this supplier's products are not listed.
Nicanor Obaldía III, et al.,
bioRxiv - Microbiology 2023
Quote:
... 17µl (∼ 5 µg) of each Cy-5-labelled (GE Healthcare) cDNA of the sample and an equal amount of Cy-3-labelled (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Paula F. Zamora, et al.,
bioRxiv - Microbiology 2024
Quote:
... and 5 U/ml penicillin-5 mg/ml streptomycin (Corning) in adherent cell culture conditions at 37°C with 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Ekaterina Petrova, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 5 µm (Agilent). Next ...
-
No products found
because this supplier's products are not listed.
Kara Anazia, et al.,
bioRxiv - Biophysics 2024
Quote:
... 5% acrylamide (BIORAD), 0.1% SDS ...
-
No products found
because this supplier's products are not listed.
Gabriel S. Jensen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stellaris 5 (Leica), or LSM 900 (Zeiss ...
-
No products found
because this supplier's products are not listed.
Anthony Lanahan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Selection for pyrF mutations was performed with 5-fluoroorotic acid (5-FOA, Zymo Research, part number F9001-5) at a final concentration of 0.5 mg/ml ...
-
No products found
because this supplier's products are not listed.
Amy J. Gleichman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
No products found
because this supplier's products are not listed.
Ons Mamai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-pSMAD1/5 (Cell Signaling), anti-SMAD4 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Raphaël Forquet, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
No products found
because this supplier's products are not listed.
Kirandeep K. Deol, et al.,
bioRxiv - Biochemistry 2020
Quote:
Adenosine-5’-triphosphate (Goldbio, Cat. # A-081-5)
-
No products found
because this supplier's products are not listed.
Hritika Sharma, Anjali Bose, Uma Kumar, Rahul Pal,
bioRxiv - Immunology 2020
Quote:
... LPS (5 µg/ml) or LPS (5 µg/ml) + concanavalin A (5 μg/ml; InvivoGen) were employed as control stimulants for splenocytes and isolated cells respectively.
-
No products found
because this supplier's products are not listed.
Omer Barda, Maggie Levy,
bioRxiv - Plant Biology 2021
Quote:
... 5 µm (Phenomenex). The mobile phases were water (A ...
-
No products found
because this supplier's products are not listed.
Hattie Chung, et al.,
bioRxiv - Genomics 2021
Quote:
... 5% normal donkey serum and 5% normal goat serum (Jackson Immunoresearch) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Daisuke Tone, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Chris H. Hill, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... A 5′ Cy5 fluorescent label was incorporated using the 5′ EndTag kit (Vector Labs) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Arya Bagus Boedi Iswanto, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 5 µM FB1 (Santa Cruz), 50 µM PDMP (Santa Cruz) ...
-
No products found
because this supplier's products are not listed.
Giulia Ferrari, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5% CO2 in EGM1 (Lonza) on 1% gelatin-coated flasks (Sigma) ...
-
No products found
because this supplier's products are not listed.
Caleb J. Rux, et al.,
bioRxiv - Physiology 2021
Quote:
... included 5-month (n = 5) and 22-month-old (n = 5) female C57Bl/6 mice from Charles River Laboratory ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
No products found
because this supplier's products are not listed.
Sk. Kayum Alam, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and either cryopreserved in 85% RPMI-1640 (Corning)/10% FBS (Millipore)/5% DMSO (MP Biomedicals) for future use or suspended in 100 μL PBS and high-concentration Matrigel on ice (5 × 106 cells per mouse) ...
-
No products found
because this supplier's products are not listed.
Lauren M. Saunders, et al.,
bioRxiv - Genomics 2022
Quote:
... 5% fixation buffer [5% paraformaldehyde (EMS, cat. no. 50-980-493), 1.25x dPBS] was added to each well ...
-
No products found
because this supplier's products are not listed.
Trisha A. Macrae, Miguel Ramalho-Santos,
bioRxiv - Molecular Biology 2020
Quote:
... 5 min total (Diagenode).
-
No products found
because this supplier's products are not listed.
Lucia F. Zacchi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Two 5 L bioreactors (Sartorius) were seeded at 0.3 x 106 cells/mL in 3 L (total working volume ...
-
No products found
because this supplier's products are not listed.
Mandy Y. Boontanrart, et al.,
bioRxiv - Genetics 2022
Quote:
... 5 mL (Beckman Coulter, B23317) using a DynaMag™-2 Magnet magnetic stand (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Raquel Guillamat-Prats, et al.,
bioRxiv - Immunology 2021
Quote:
... Calcium 5 Assay Kit (Molecular devices) for 1 h at 37° C ...
-
No products found
because this supplier's products are not listed.
Sung Ji Ahn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a map of the vasculature was taken through a ×5 objective (MPlan N 5□×□0.1 NA, Olympus) and compared with laser speckle map to locate the same imaging field in the whisker barrel cortex and identify pial vessels branches that feed the barrel cortex ...