-
No products found
because this supplier's products are not listed.
Kristin S. Fitzpatrick, et al.,
bioRxiv - Immunology 2022
Quote:
... and Vaccinia virus B8R (TSYKFESV, Biomatik).
-
No products found
because this supplier's products are not listed.
Jieqiong Qu, et al.,
bioRxiv - Microbiology 2023
Quote:
... CHIKV virus stock (5 × 108 TCID50/mL) and full human blood (Sanquin) was 1:2 mixed to make the infectious blood meal with a final virus titer of 1.7× 108 TCID50/ml ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Taeyong Kwon, et al.,
bioRxiv - Microbiology 2022
Quote:
... The same amount of the virus was mixed with 45 µL of human saliva (Lee Biosolutions) or medium and transferred into a 2 mL tube or onto stainless steel in the 12-well plate ...
-
No products found
because this supplier's products are not listed.
Daniela Niemeyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... and B.1.351 was assessed by a surrogate virus neutralization test (cPass Assay, Medac, Wedel, Germany) as described previously (Momsen Reincke et al. ...
-
No products found
because this supplier's products are not listed.
Paula Lagan, et al.,
bioRxiv - Microbiology 2023
Quote:
... Successful virus isolation was confirmed either by haemagglutination of 0.5% chicken blood cells (Envigo #S.B-0008) or by RRT-PCR.
-
No products found
because this supplier's products are not listed.
Susanne A. Wycislo, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Equivalent amounts of “light”-labeled control and “heavy”-labeled GFP–containing lysates or “light”-labeled control and “heavy”-labeled GFP–containing lysates were incubated (separately) with GFP-Trap agarose beads (Allele Biotechnology, San Diego, CA) for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Eugenia Zah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The lysate supernatant was ultracentrifuged with iodixanol (OptiPrep; StemCell Technologies) density gradient solutions (54% ...
-
No products found
because this supplier's products are not listed.
Lisa-Marie Kuhl, et al.,
bioRxiv - Genetics 2020
Quote:
... Cell lysates were mixed on a VXR basic Vibrax (IKA) for 2 min at 1500 rpm ...
-
No products found
because this supplier's products are not listed.
Meredith J. Sigman, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Clarified lysates were combined with 2 μL of AGO4 antibody (Agrisera) or 2uL of rabbit IgG as a mock IP (Cell Signaling Technology) ...
-
No products found
because this supplier's products are not listed.
Jie Dong, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The lysate was filtered through a 30 μm mesh (Sysmex Partec). Propidium iodide (Sigma ...
-
No products found
because this supplier's products are not listed.
Anna Fortuny, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Lysates were homogenised with a tight Dounce homogeniser (DWK Life Sciences) and nuclei were collected by centrifugation ...
-
No products found
because this supplier's products are not listed.
Han Sun, et al.,
bioRxiv - Microbiology 2023
Quote:
... Lysates were then injected with 40 µl firefly luciferin substrate (Biosynth) and luminescence was measured using a SpectraMax L plate reader (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Milène Vandal, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The lysate was incubated with 100 U/mL salt-active nuclease (Arcticzymes) at 37°C for 1 h and then centrifuged at 2000 xg for 15 min ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
No products found
because this supplier's products are not listed.
James Brett Case, et al.,
bioRxiv - Microbiology 2020
Quote:
... Virus was plaque-purified on Vero CCL81 cells in the presence of 25 μg/ml of cytosine arabinoside (TriLink BioTechnologies), and plaques in agarose plugs were amplified on Vero CCL81 cells ...
-
No products found
because this supplier's products are not listed.
Avital Licht-Murava, et al.,
bioRxiv - Neuroscience 2022
Quote:
... per ml culture medium at DIV 8 using Lipofectamine 3000 5 h before infection with vesicular stomatitis virus (VSV) at 100 MOI or with adenovirus-eGFP (Ad5CMV-eGFP, lot #ad3586, Viral Vector Core Facility, Carver College of Medicine ...
-
No products found
because this supplier's products are not listed.
Sara Al Rawi, et al.,
bioRxiv - Neuroscience 2021
Quote:
Fbxo7 was immunoprecipitated from cell lysates using 2μl of anti-Fbxo7 antibody (Aviva), or isotype matched control ...
-
No products found
because this supplier's products are not listed.
Jay Leipheimer, et al.,
bioRxiv - Microbiology 2019
Quote:
Whole-cell lysate from yeast cultures was obtained by glass bead((#9831 RPI) mediated mechanical disruption using Bullet Blender Gold (Next Advance Model:BB2U-AU ...
-
No products found
because this supplier's products are not listed.
Vigneshwaran Venkatesan, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the protein lysate was analysed for haemoglobin tetramer using G8 HPLC Analyzer (Tosoh). The globin chain analysis was performed using HPLC equipment with UV detector (Shimadzu ...
-
Cat# ZK312-1,
USD $795.0/mg
Ask
Milica Moskovljevic, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells stimulated with either lysates of CMV-infected fibroblasts (Virusys, 10 μg/mL), overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A further lysate (600 μl) was incubated with 5 μg rabbit immunoglobulins (Vector Laboratories) to control for nonspecific interactions ...
-
No products found
because this supplier's products are not listed.
Nitin Raj, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the pre-cleared lysates were incubated with 1-2 µg Mettl3 polyclonal antibody (Abclonal, A8370) or 1-2 µg Mettl14 polyclonal antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Federica Cappuccini, et al.,
bioRxiv - Immunology 2021
Quote:
Mouse MHC samples and all tryptic digested lysates were analysed on a TripleTOF 5600 (SCIEX) coupled to an Eksigent ekspert nanoLC 400 cHiPLC system ...
-
No products found
because this supplier's products are not listed.
Julie M. Button, Suchetana Mukhopadhyay,
bioRxiv - Microbiology 2021
Quote:
Five microliters of purified virus or pelleted cores were placed on a Formvar and carboncoated 300 mesh grid (Ted Pella Inc., Redding, CA) and stained with 1% uranyl acetate ...
-
No products found
because this supplier's products are not listed.
Wenhui Qiao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Aβ oligomers in TBS and TBSX lysates were detected by commercial kits (Biosensis, BEK-2215-2P). sAPPa ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Gordon Rix, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Lysate was clarified by spinning 14,000g for 20 min at 4 °C (New Brunswick Avanti J-30I). Protein was purified over hand-packed HisPur™ Ni-NTA Resin (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Nicholas McCaul, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... IgM was immunoprecipitated from lysates or media samples with a goat anti-mouse IgM antibody (Southern Biotech). Immunoprecipitates were washed with lysis buffer and eluted from beads with reducing SDS-PAGE sample buffer and analyzed by SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Kelly T. Rios, et al.,
bioRxiv - Microbiology 2024
Quote:
The gametocyte and zygote lysates were mechanically lysed with a 1 mL Dounce homogenizer (Wheaton, Cat# 357538) for one minute on ice with a tight pestle following chemical lysis ...
-
No products found
because this supplier's products are not listed.
Matthew L. Turner, et al.,
bioRxiv - Microbiology 2019
Quote:
... Potassium was measured in the cleared lysates using a Jenway PFP7 flame photometer (Cole-Parmer, Stone, Staffordshire, UK).
-
No products found
because this supplier's products are not listed.
Michael J. D. Daniels, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 25 μL lysate was combined with 175 μL cathepsin probe L (Z-Phe-Arg-AMC, 45 μM, Bachem) or C (H-Gly-Phe-AMC ...
-
No products found
because this supplier's products are not listed.
Sana Charaoui-Boukerzaza, et al.,
bioRxiv - Microbiology 2019
Quote:
... The count of viable bacteria was carried out by plating serial dilutions of the lysates on blood agar (43041, bioMérieux) using an automatic seeder (EasySpiral Dilute, Interscience). The calculation of the bacterial loads was performed after incubation at 37°C for 24 h ...
-
No products found
because this supplier's products are not listed.
Kuan-Yi Lu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 mg parasite protein lysate was precleaned with 600 μL uncoated agarose beads (Echelon Biosciences, Salt Lake City, UT) at 4 °C for 90 min ...
-
No products found
because this supplier's products are not listed.
Trevor J. Hancock, et al.,
bioRxiv - Immunology 2022
Quote:
... as well as TGEV (transmissible gastroenteritis virus) (VMRD, Pullman, WA, USA). Normal cat serum was purchased from Jackson ImmunoResearch (West Grove ...
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... goat anti- xenotropic MLV virus antibody ABIN457298 (1:1000, antibodies-online); mouse anti- MLV gag ab100970 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Zhenming Jin, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Anti-virus Drug Library (Shanghai Institute for Advanced Immunochemical Studies, SIAIS), which includes ∼10,000 compounds ...
-
No products found
because this supplier's products are not listed.
Subeena Sood, et al.,
bioRxiv - Immunology 2023
Quote:
... A fixed concentration of SARS-CoV-2 GFP pseudotyped virus (BPS Biosciences) was added and the plate incubated for 60 minutes at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Katharina Kases, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and anti- ZC3H11A (Atlas Antibodies, heavy lysate) antibodies in Protein LoBind tubes (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Hongyan Sui, et al.,
bioRxiv - Immunology 2019
Quote:
HSV-1 (MacIntyre strain) and Sendai virus (SeV) were obtained from Advanced Biotechnologies Inc ...
-
No products found
Yuanyuan He, et al.,
bioRxiv - Microbiology 2023
Quote:
Imaging plates for virus quantification were prepared by coating coverslip-bottom wells (Cellvis) with 0.18 mg/ml BSA-biotin in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Luis E. Martinetti, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we used a virus-retrobead or saline-retrobead mixture (red RetroBeads, Lumafluor, Cat# R180). When comparing different AAV serotypes ...
-
No products found
because this supplier's products are not listed.
Sheng Xiao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Virus was injected using a manual volume displacement injector (Narishige International USA, MMO-220A) connected to a glass pipette (Drummond Scientific ...
-
No products found
because this supplier's products are not listed.
DaoFei Song, Lei Yin, Chang Wang, XiuYing Wen,
bioRxiv - Molecular Biology 2019
Quote:
... The protein concentration in tissue lysates was measured with a BCA protein assay kit (Boster, Wuhan, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Akira Kitamura, et al.,
bioRxiv - Biophysics 2023
Quote:
... FCCS measurements of the lysates were performed using an LSM510 META ConfoCor3 system (Carl Zeiss, Jena, Germany) equipped with a C-Apochromat 40×/1.2NA W Korr ...
-
No products found
because this supplier's products are not listed.
Julieta Ramirez, et al.,
bioRxiv - Genomics 2023
Quote:
Whole cell lysates were separated on a 5% SDS/PAGE containing 20 μm Phos-tag (NARD Institute), followed by western blotting with anti-CTCF antibody.
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
... the clarified lysate was concentrated by tangential flow filtration at 5 L/min/m2 using a KR2i KrosFlo (Repligen) with Pellicon 2 mini cassettes (300 kDa ...
-
No products found
Liliana M. Sanmarco, et al.,
bioRxiv - Immunology 2023
Quote:
Pyruvate levels were quantified in BMDC lysates after 1h stimulation using EnzyChrom pyruvate assay kit (EPYR-100, BioAssay Systems), followed the procedure suggested by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Jose L. Nieto-Torres, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The in vitro kinase reaction mixtures were incubated with 350 μl clarified lysate of HeLa LC3B-KO cells (8×105 cell equivalents, prepared as described above) and glutathione-sepharose beads (Bioworld) for 3 h at 4°C on a rotator ...
-
No products found
because this supplier's products are not listed.
Nitchakarn Kaokhum, et al.,
bioRxiv - Biochemistry 2022
Quote:
DUB activity in cartilage tissue lysates were measured using ubiquitin-rhodamine(110)-glycine quenched substrate (Boston Biochem, cat No U-555). In the presence of active DUBS ...