-
No products found
because this supplier's products are not listed.
Pranav Preman, et al.,
bioRxiv - Neuroscience 2020
Quote:
... supplemented with 10 ng/ml FGF2 StemBeads (StemCultures) were differentiated to neural progenitor cells (NPCs ...
-
No products found
because this supplier's products are not listed.
Ana Carolina A. L. Campos, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and Fe supplied as 10μM Fe-HBED N,N’-di(2-hydroxybenzyl)ethylenediamine-N,N’-diacetic acid monohydrochloride hydrate (Strem Chemicals, Inc., UK). Plant growth trays were rotated every day to help reduce gradient effects of light ...
-
No products found
because this supplier's products are not listed.
Łukasz Mazurek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 0.1 mg/ml albumin) and 500 ng relaxed pBR322 DNA (Inspiralis Ltd). For Ca2+ induced cleavage ...
-
No products found
because this supplier's products are not listed.
Sahiti Kuppa, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 180 μl of this working stock was added to a 3 mm pathlength quartz cuvette (Starna Cells Inc.) and the temperature was maintained at 23 °C ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Yan Zou, Tian Chi,
bioRxiv - Cancer Biology 2021
Quote:
The cytolytic capability of CAR T cells over a 180-h period was monitored using xCELLigence RTCA system (ACEA Biosciences). MDA-MB-453 or U251-CD133OE were plated in E-plate (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Makenna M. Morck, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 500 U/mL pyruvate kinase (product #500-20, Lee Biosolutions, Maryland Heights, MO, USA), 2.5 mM phospho(enol ...
-
No products found
because this supplier's products are not listed.
Kyoko Tossell, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Coronal brain slices (170-μm thickness) encompassing the PFC were obtained using a vibratome (Vibrating Microtome 7000smz-2; Campden Instruments LTD, UK). Slices were transferred to a submersion chamber and continuously perfused at a rate of 1-2 ml/ min with fully oxygenated aCSF at room temperature ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, et al.,
bioRxiv - Microbiology 2021
Quote:
... and whole Spike (20 µg/ml)] were covalently fixed with ultraviolet irradiation to a 12-230 kDa Jess & Wes Separation Module (Protein Simple). The immobilized viral components were then exposed to each of 30-fold-diluted convalescent plasma samples (primary antibodies) ...
-
No products found
because this supplier's products are not listed.
Hyunjun Yang, Adam G. Kreutzer, James S. Nowick,
bioRxiv - Microbiology 2023
Quote:
... Fmoc-N-Me-D-Gln(Trt)-OH was purchased from ChemPep. Other protected amino acids were purchased from CHEM-IMPEX ...
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti Cav2.3 N-terminus 1:250 (Covalab, custom 1, HEK293 & brain), rabbit anti pS15 Cav2.3 1:500 (Covalab ...
-
No products found
because this supplier's products are not listed.
Nenad Suknovic, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... counterstained with 20 µM Draq5 (Biostatus) for 30 min ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Matsuda, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Signals were detected by N-Histofine® DAB-3S kit (Nichirei Bioscience Inc.). Details of used antibodies are listed in Extended Data Table 6.
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Following secondary antibodies were used: monoclonal N- and S- specific IgG antibodies (Hytest, rabbit IgG ...
-
Dinara Bulgari, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 10K and 20 K (Biochempeg Scientific Inc.) were coupled to MG-EDA-alkyne via click reaction (Szent-Gyorgyi et al. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Ako Rezaei, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 20 nM MitoQ (MedKoo Biosciences Inc., Morrisville, NC, USA) (MT20) ...
-
No products found
because this supplier's products are not listed.
Hemangini A Dhaibar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1:20 (clone N206A/8, Antibodies Incorporated, Davis, CA); rabbit polyclonal anti-ionized calcium binding adaptor molecule 1 (Iba1) ...
-
No products found
because this supplier's products are not listed.
Johnathon L. Rose, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Nested PCR was utilized to amplify and prepare barcode populations for NGS (Cellecta).
-
β-N-Acetylglucosaminidase Assay Kit
Cat# DNAG-100,
1.0 kit, 100 tests, USD $359.0
Ask
Anna Yang, Tahina O. Ranaivoarisoa, Arpita Bose,
bioRxiv - Microbiology 2023
Quote:
... and 20% using the Ethanol Assay Kit provided by BioAssay Systems (catalog no ...
-
No products found
because this supplier's products are not listed.
Madeleine A. G. Gilbert, et al.,
bioRxiv - Pathology 2023
Quote:
... equipped with trimming (Trim 20, T399) and CEMOVIS (Diatome, cryo immuno, MT12859) diamond knives ...
-
No products found
Hiram Luna-Munguia, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 192-IgG-saporin (375 ng/µl dissolved in sterile 0.1X PBS; n=16; Advanced Targeting Systems), PBS (0.1X dissolved in sterile saline solution ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
... ClinicalTrials.gov Identifier: NCT04380896) who tested positive in a commercial screening assay for anti-Nucleocapsid IgG (Epitope Diagnostics Inc, San Diego, USA) (iii ...
-
No products found
because this supplier's products are not listed.
Philippe Dehio, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The thawed cells were resuspended in complete medium & 10 ng / ml GM-CSF and 100 ng / ml LPS (Lucerna Chem, Cat. # abx082480) and matured for 14 h for migration experiments.
-
No products found
because this supplier's products are not listed.
Simona Selberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Human recombinant GDNF (100 ng/ml) (Icosagen AS, Tartu, Estonia) or a condition without any neurotrophic compound added were used as positive and negative controls ...
-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
No products found
because this supplier's products are not listed.
Samuel Schmidt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... P/N was supplemented with β1,4 galactosidase at 150 mU/mL (QA-Bio, E-BG07), cleaving non-reduced terminal β1-4 galactose (G ...
-
Cat# 31508-00-6,
Inquire
Ask
Minjoo Kim, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The resulting whole cell lysate was then tumbled with N,N-dimethyl-N-dodecylglycine (Empigen BB Detergent, BOC Sciences) (3% v/v ...
-
No products found
because this supplier's products are not listed.
Shiho Yasue, et al.,
bioRxiv - Cell Biology 2023
Quote:
... USA) or 30 ng/ml MAPK kinase (MEK) inhibitor (trametinib; ChemScene, Monmouth Junction, NJ, USA) was added to these cells for examination of drug inhibition.
-
No products found
because this supplier's products are not listed.
Anne Helness, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... HEL (ATCC TIB-180) cells were maintained in RPMI media (Multicell) supplemented with 10% Bovine Growth Serum (RMBIO Fetalgro) and 100 IU Penicillin and 100μg/ml Streptomycin (Multicell) ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... Young adult male Sprague-Dawley rats (Harlan; 180-190 g BW) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and fixed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Fatina Siwczak, et al.,
bioRxiv - Microbiology 2021
Quote:
... extracellular bacteria were killed and removed by treatment with 20 μg/ml lysostaphin (WAK-Chemie Medical GmbH, Steinbach/Ts., Germany) for 30 min at the vascular and hepatic side of the model ...
-
No products found
because this supplier's products are not listed.
Maya Elgrably-Weiss, et al.,
bioRxiv - Microbiology 2023
Quote:
... 20 units RNase inhibitor (CHIMERx), 500 μM of each NTP ...
-
No products found
because this supplier's products are not listed.
Shalini Gupta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The N- and C-peptides were labeled with maleimide-derivatized DY549P1 (Dyomics), DY649P1 (Dyomics) ...
-
No products found
because this supplier's products are not listed.
Costanza Borrelli, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 1 ng/uL anti-SEMA4D monoclonal antibody (Pepinemab Biosimilar, Proteogenix PX-TA1382 or 1 ng/uL anti-PLXNB2 monoclonal antibody (67265-1 ...
-
No products found
because this supplier's products are not listed.
Yue Hu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... ISO group (n=6) mice were handled and inhaled 1.5% isoflurane (RWD Life Science, 1903715) at 13:00 on day four in the chamber ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... were coated with 300 ng human IgM (CP initiator) (Athens Research & Technology) in 100 μl/well of coating buffer (see above ...
-
No products found
because this supplier's products are not listed.
Amanda E Cherwin, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Sections were blocked in PBS with 5% normal goat serum (NGS; Lampire Biological, Pipersville, PA), 1% hydrogen peroxide ...
-
No products found
because this supplier's products are not listed.
Thibault Scalvenzi, et al.,
bioRxiv - Genomics 2021
Quote:
... 20 and 5 μm filters (nylon 40 μm cell strainer from BIOLOGIX; 20 μm net ring from Pharmacia Fine chemicals ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Brier, Joseph P. Culver,
bioRxiv - Neuroscience 2021
Quote:
... The N=16 mice used for FC matrix computation had stainless steel EEG self-tapping screws (BASI Inc., West Lafayette, IN, USA) fixed at approximately -1mm posterior to bregma ...
-
No products found
because this supplier's products are not listed.
Erez Dror, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and stored at −20°C for later insulin measurements using ultrasensitive insulin ELISA (Mercodia).
-
No products found
because this supplier's products are not listed.
Jasvinder S. Ahuja, et al.,
bioRxiv - Genetics 2021
Quote:
... cells were pelleted and resuspended in 4 mL YPD broth containing 100 µg/mL nourseothricin sulfate (Neta Scientific) and aerated at 30°C for 12 h ...
-
No products found
because this supplier's products are not listed.
Qian Yu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... bovine insulin (1 μg/ml, Akron Biotech), and penicillin/streptomycin for 24 h and then in antibiotic-free media for another 24 h ...
-
No products found
because this supplier's products are not listed.
Dapeng Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
... SMG) and the normal gravity control (NG) were set up in a high-aspect rotating vessel (HARV) bioreactor (Synthecon, Inc., Houston, Texas, USA) and cultured continuously ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, et al.,
bioRxiv - Biophysics 2023
Quote:
... Reactions incubated for 5 min at 20 °C before imaging in 96-well chambered coverglass (Brooks Life Science Systems). Samples were imaged using a Nikon A1R Confocal Microscope with a 60x oil immersion lens at the Imaging and Cell Analysis Core Facility at Tufts University School of Medicine ...
-
No products found
because this supplier's products are not listed.
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 20 μl of cell-gel solution per well was pipetted into ethanol sterilized 96-well black U-bottom plate (BrandTech #781607). Hydrogels were photopolymerized with 4 mW/cm2 of 365 nm UV light for 180 seconds ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Blasi Maria, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were then incubated with 2 μg/ml biotinylated rabbit anti-human IFN-γ (U-CyTech biosciences, Utrecht, The Netherlands) for 2 hours at room temperature ...