-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Michael Song, et al.,
bioRxiv - Genomics 2019
Quote:
... i3LMN iPSCs were maintained on growth factor reduced Matrigel in StemFit media (Nacalai USA). On day 0 ...
-
No products found
because this supplier's products are not listed.
Marie-Claire Dagher, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Thrombin generation was triggered by 1pM tissue factor and 4μM phospholipids (PPP-reagent low, Diagnostica Stago) in the presence of a fluorogenic substrate (FluCa kit) ...
-
No products found
because this supplier's products are not listed.
Emily H. Adhikari, et al.,
bioRxiv - Immunology 2023
Quote:
... plates were incubated overnight at 4°C with primary antibody (1:5,000 anti-SARS-CoV-2 alpaca serum) (Capralogics Inc) (126) ...
-
No products found
because this supplier's products are not listed.
Morgane Batzenschlager, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The p35S::CYCD3;1-HA construct was co-transformed with binary vectors allowing native expression of cell cycle regulated-reporters (pH4::GUS, pKNOLLE::GUS, pKNOLLE::eGFP-KNOLLE) and constitutive expression of transcription factors (NF-YA1, NF-YA1mutDBD) from Medicago. All plasmids used in the experiments involving the CDEL system are listed in Table S1 ...
-
No products found
because this supplier's products are not listed.
David S. Milner, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 2 Bacteriological (Neogen)] or Scm-his agar (containing CSM-histidine in place of CSM-uracil) ...
-
No products found
because this supplier's products are not listed.
Jan Stephan Wichers, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... were normalized with the number of 3D7 mappable reads in each isolate using bamCoverage by introducing a scaling factor to generate bigwig files displayed in Artemis (Carver et al, 2012).
-
No products found
because this supplier's products are not listed.
Christina Pressl, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slides were washed with PBS and Streptavidin-HRP conjugate (NEL-700 NEN Life Science Products) (1:100 ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2-hydroxy-1-naphthaldehyde (Ark Pharm); and 2-amino-N-(1-phenylethyl)benzamide (Enamine).
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Yun Liu, Weichun Lin,
bioRxiv - Neuroscience 2022
Quote:
... μ-conotoxin GIIIB (2 μM; Peptides International) was added to the bath solution 30 minutes prior to recording ...
-
No products found
because this supplier's products are not listed.
Sebastian Schaefer, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2-(butylthiocarbonothioylthio)propanoic acid (BTPA, Boron Molecular) and 5,10,15,20-tetraphenyl-21H,23H-porphine zinc (ZnTPP ...
-
No products found
because this supplier's products are not listed.
Mikala C. Mueller, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Ethyl 2-(bromomethyl)acrylate (EBrMA; Ambeed, Inc.) was added drop-wise at a 6x molar ratio to PEG-OH groups ...
-
No products found
because this supplier's products are not listed.
Prakash Thapa, et al.,
bioRxiv - Immunology 2019
Quote:
... with 2% human serum (Valley Biomedical Products & Services) with 800 U/mL granulocytemacrophage colony-stimulating factor (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Sabrina Haas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All antibodies were diluted in antibody diluent (IW-1000, IHC World, LLC, Woodstock, MD, USA) and incubated for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Sangam Kandel, et al.,
bioRxiv - Genomics 2023
Quote:
... Samples were tested for the SARS-CoV-2 using the Aptima® SARS-CoV-2 (Panther® System, Hologic, San Diego, CA) nucleic acid amplification assay ...
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
Ulri N. Lee, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 2 g of Yeast Extract (United States Biological Corporation ...
-
No products found
because this supplier's products are not listed.
Rajashree A. Deshpande, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 2 µL of 100 µM caged AluGG crRNA (Bio-Synthesis)36 was mixed with 2 µL of 100 µM tracrRNA (Integrated DNA Technologies ...
-
No products found
because this supplier's products are not listed.
Soheila Kazemi, et al.,
bioRxiv - Microbiology 2021
Quote:
... All Thy1.1 antibodies (unlabeled, and FITC conjugated) were from eBiosciences and APC-coupled anti-ACE2 antibody was from Abeomics. All antibodies were used according to manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Elizabeth M. Haynes, et al.,
bioRxiv - Neuroscience 2022
Quote:
Kinesore was acquired from the Hit-2-Lead library (Chembridge, compound #6233307) and suspended in DMSO for a stock concentration of 100 mM ...
-
No products found
because this supplier's products are not listed.
Robyn M. Barfield, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The murine anti-maytansine antibody was made by ProMab and validated in-house ...
-
No products found
because this supplier's products are not listed.
Saba Goodarzi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... separated by a 1 mm sticky spacer (2×0.5mm thick Ispacer, SunJin Lab).
-
No products found
because this supplier's products are not listed.
Daniel Abebayehu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... fibroblasts were cultured on 2 kPa polyacrylamide hydrogels that were purchased from Matrigen and came chemically activated ready to bind matrix proteins ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Filip Yabukarski, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The sample contained 1 mM KSI and 2 mM equilenin (Steraloids, Newport, RI, USA) in 40 mM potassium phosphate (pH 7.2) ...
-
Cat# USF2-3689H,
25ug : USD $319
Ask
Sunil Yeruva, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were coated with 2 µg ml-1 recombinant human DSG2 (Creative Biomart; #DSG2-1601H) in 100 mM bicarbonate/carbonate coating buffer (3.03 g Na2CO3 ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 25-gauge butterfly needle attached to a peristaltic pump (#Minipuls 2; Rainin). Brains were removed and postfixed overnight at 4°C and then cut into 50 µm coronal sections using a vibratome (#TPI1000 ...
-
No products found
because this supplier's products are not listed.
Mustafa G. Aydogan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2) The mCherry tag was replaced with either mNeonGreen (Shaner et al., 2013) (Allele Biotechnology) or mKate2 (Shcherbo et al. ...
-
No products found
because this supplier's products are not listed.
Ryan Philip Henry Shaw, et al.,
bioRxiv - Physiology 2021
Quote:
Tail samples were digested in a 200:2 ratio of Tail lysate (VIAGEN 102-T) to proteinase K overnight in 55°C water bath overnight and then inactivated at 85°C for 45 min ...
-
No products found
because this supplier's products are not listed.
J. Graham Ruby, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... Animal cages were changed every 2 weeks within a cage change station (NuAire, Plymouth, MN). Mice were transferred between cages using red transparent acrylic tunnels (Bio-Serv ...
-
No products found
because this supplier's products are not listed.
Craig T. Jacobs, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... for fluorescent detection of antibody staining and Draq5 (1:10,000, Biostatus) was used for nuclear staining ...
-
No products found
because this supplier's products are not listed.
Elsa Mazari-Arrighi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... rabbit anti-rat albumin antibody (RaRa/ALB/7S, Nordic-MUbio, Netherlands) was used as primary antibody and biotinylated goat anti-rabbit antibody (VECTASTAIN Elite ABC HRP Kit ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Emily Speranza, et al.,
bioRxiv - Immunology 2021
Quote:
... slides were de-waxed according to a standard protocol of 2 washes of Xylene (Newcomer Supply) for 10 minutes each ...
-
No products found
because this supplier's products are not listed.
Rosalba Perrone, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Slides were incubated with the following protocol: 2 minutes in Modified Mayer’s Hematoxylin (StatLab, McKinney, TX, HXMMHGAL), 2 washes with dH20 ...
-
No products found
because this supplier's products are not listed.
Mesfin Meshesha, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and SARS-CoV-2 lineage B.1.1.529 (Omicron Variant) culture fluid (UV inactivated, 0810642UV, Zeptometrix LLC, USA) and (heat inactivated ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Lisa Y. Beppu, et al.,
bioRxiv - Immunology 2019
Quote:
... Blood glucose was measured using a handheld glucometer (OneTouch Ultra 2) and plasma insulin was measured by ELISA (Alpco). For the glucose tolerance tests (GTTs) ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
No products found
because this supplier's products are not listed.
Ankita M. George, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse monoclonal antibody targeting the nucleocapsid protein of CDV (CDV-NP, VMRD, WA, USA) was used at a dilution of 1:2000 (60 min incubation) ...
-
No products found
because this supplier's products are not listed.
Olivia E. Mosley, et al.,
bioRxiv - Microbiology 2021
Quote:
... and specific conductance (SPC or conductivity) were measured on-site using a flow-through cell and field probes (YSI EXO sonde 2, YSI PRO + and YSI ProDSS ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
Bcl-2 and its homologs belong to a family of proteins that either promotes or prevent apoptosis....
Cat# PBCA1037,
Inquiry
Ask
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pseudovirus (an HIV-based luciferase expressing lentivirus pseudotyped with SARS-CoV-2 full length S protein) was obtained from Creative Biogene. One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Guy Schleyer, et al.,
bioRxiv - Microbiology 2022
Quote:
... The upper organic phase (1.5 mL) was transferred to 2 mL centrifuge tubes and dried under a flow of nitrogen (TurboVap LV, Biotage, Uppsala, Sweden). The polar phase was re-extracted with 1.5 mL of MTBE ...