-
No products found
because this supplier's products are not listed.
Jessica Gartrell, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... using a rabbit anti-SLFN11 (anti-Schlafen family member 11) polyclonal antibody (Sigma-Aldrich Cat# HPA023030, RRID:AB_1856613) (1:25 dilution ...
-
No products found
because this supplier's products are not listed.
Rajakumar Selvaraj, et al.,
bioRxiv - Cell Biology 2021
Quote:
... acyl-CoA synthetase long-chain family member 1 (ACSL1) (1:1000, Cell Signaling, #4047), perilipin 2 (PLIN2 ...
-
No products found
because this supplier's products are not listed.
Rui Xiao, et al.,
bioRxiv - Physiology 2019
Quote:
... PCR probe for Cela1 (chymotrypsin-like elastase family, member 1) was purchased from ThermoFisher (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Kellman, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 mM UDP-Gal (Promega) for B3GALT2 ...
-
No products found
because this supplier's products are not listed.
Jining Jia, et al.,
bioRxiv - Neuroscience 2020
Quote:
... solute carrier family 7 member 11 (SLC7A11) (rabbit, 55 kDa, ab175186, 1:5000, Abcam), Anti-5 Lipoxygenase (5-LOX ...
-
No products found
because this supplier's products are not listed.
Christina Pressl, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Solute Carrier Family 1 Member 3 (SLC1A3, Santa Cruz sc-515839 used at a concentration of 1:2000) ...
-
No products found
because this supplier's products are not listed.
Emma Bergsten, et al.,
bioRxiv - Microbiology 2023
Quote:
... and a 1:500 dilution of an antibody against the phosphorylated form of H2A histone family member X (γH2Ax) (clone JBW301, Merck) and 1:200 phalloidin coupled to Alexa Fluor 568 ...
-
No products found
because this supplier's products are not listed.
Grant D. Jones, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Affinity-purified rabbit polyclonal antibodies specific to each eIF4E family member (Genscript) were used as the primary probe in western blotting ...
-
No products found
because this supplier's products are not listed.
Danielle L Blackwell, et al.,
bioRxiv - Developmental Biology 2021
Quote:
DNA was extracted from all family members from whole blood using Puregene chemistry (Qiagen). Exome capture was undertaken in both affected individuals using the SureSelect 50 Mb All Exon Kit v3 (Agilent ...
-
No products found
because this supplier's products are not listed.
J.M. Crowther, et al.,
bioRxiv - Biophysics 2019
Quote:
... anti-bovine IgG (Bethyl Lab A10-118P 1:75K) and anti-bovine IgA (Bethyl Lab A10-131P 1 ...
-
No products found
because this supplier's products are not listed.
Andrea Wetzel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
No products found
because this supplier's products are not listed.
Niccolò E. Mencacci, et al.,
bioRxiv - Genetics 2020
Quote:
... A genome-wide analysis genotyping scan was performed in all six members of family A and in the proband of family B using the HumanCytoSNP-12 DNA Analysis BeadChip Kit (Illumina, San Diego), according to manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Mingeum Jeong, et al.,
bioRxiv - Immunology 2022
Quote:
... anti-NKG2D (clone A10; Biolegend), or anti-NKp46 (polyclonal goat IgG ...
-
No products found
because this supplier's products are not listed.
Jorge Larriva-Sahd, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The FITC-UDP detection was using peroxidase conjugated anti-FITC antibody (Roche) and FITC-tyramide signal amplification system (Akoya bioscience).
-
No products found
because this supplier's products are not listed.
Li Zhong, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ATP binding cassette subfamily A member 1 (Abca1; 1:500, Ag24118; Proteintech), Patched (Ptch ...
-
No products found
because this supplier's products are not listed.
Abigael Cheruiyot, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Activity of the SMG1i against other PI3 kinase family members (PI3Kα, PI3Kβ, PI3Kγ, PI3Kδ, MTOR) was evaluated using Amplified Luminescent Proximity Homogeneous Assay (Alpha) Screen assays (Perkin Elmer and Echelon Biosciences). PI3K or mTOR protein (produced in Sf9 cells ...
-
No products found
because this supplier's products are not listed.
Charlotte H. Hurst, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and UDP-glucose pyrophosphorylase (Agrisera AS05 086) were all used at 1:2500 ...
-
No products found
because this supplier's products are not listed.
Liping Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... The members were visualized on X-ray films or ChemiDoc Imaging System (BioRad, Hercules, CA) following the reaction with the enhanced chemiluminescence substrate (SuperSignal™ West Pico PLUS Chemiluminescent Substrate ...
-
No products found
because this supplier's products are not listed.
Philippe F.Y. Vincent, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the Basic Helix-Loop-Helix Family Member BHLHB5 Cre mice (Bhlhb5Cre/+29,30) crossed with homozygous floxed Ai9 mice (Ai9fl/fl; Td-Tomato, Jackson Laboratory #007905) and 3 ...
-
No products found
because this supplier's products are not listed.
Zhaofa Wu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... UDP-glucose (Tocris), MRS-2500 (Tocris) ...
-
No products found
because this supplier's products are not listed.
Alon Wellner, et al.,
bioRxiv - Bioengineering 2020
Quote:
A computationally designed 200,000-member naïve nanobody CDR3 library was synthesized as an oligonucleotide pool of CDR3 sequences by Agilent, as previously reported (29) ...
-
No products found
because this supplier's products are not listed.
Raquel Martinez-Curiel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... member 3A (Wnt3A) (10 ng/mL, R&D Systems) and cyclopamine (1 μM ...
-
No products found
because this supplier's products are not listed.
Michael Warkala, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... The following antibodies were used 1° antibodies: anti-Pecam1 (1:200, BD Pharmingen, cat #550274), anti-VEGFR2 (1:200 ...
-
No products found
because this supplier's products are not listed.
Mohansrinivas Chennakesavalu, et al.,
bioRxiv - Genomics 2023
Quote:
... Glucosylation reactions were performed in a 50µl solution containing sonicated DNA with UDP-Azide-Glucose (Active Motif 55020), T4 beta-glucosyltransferase and 10X EPi Buffer (Fisher Scientific FEREO0831 ...
-
No products found
because this supplier's products are not listed.
Daigo Inoue, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-Desmocollin-1 antibody (HPA012891, ATLAS ANTIBODIES). The secondary antibodies used were as follows ...
-
No products found
because this supplier's products are not listed.
Sara Zocher, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were incubated for 1 h and secondary antibodies (1:1000; Jackson ImmunoResearch) for 30 min in PBS supplemented with 3 % normal donkey serum and 0.2 % Triton X-100 ...
-
No products found
because this supplier's products are not listed.
Sven Heiling, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 5 mM UDP-α-D-glucose (Calbiochem, http://www.merckmillipore.com) and 250 μg/mL 17-hydroxygeranyllinalool ...
-
No products found
because this supplier's products are not listed.
Mari Takalo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... antibody with respective secondary antibodies (1:5000, GE Healthcare).
-
No products found
because this supplier's products are not listed.
Junjie Gao, et al.,
bioRxiv - Microbiology 2021
Quote:
... Neuropilin-1 antibody (Novus Biologicals). Proteins were visualized by enhanced chemiluminescence and autoradiography (FujiFilm LAS-3000/4000 Gel Documentation System).
-
No products found
because this supplier's products are not listed.
H.G. Körschen, et al.,
bioRxiv - Biophysics 2021
Quote:
... Secondary antibodies were IRDye680 and IRDye800 antibodies (LI-COR, 1:25,000).
-
No products found
because this supplier's products are not listed.
Rong-rong He, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and human uridine 5’-diphosphoglucuronosyltransferase (UGT) enzymes (UGT1A1, UGT1A3, UGT1A6, UGT1A7, UGT1A8, UGT1A9, UGT1A10, UGT2B4, UGT2B7, UGT2B10, UGT2B15, and UGT2B17) were obtained from Corning Gentest ...
-
No products found
because this supplier's products are not listed.
Chien-Ting Wu, et al.,
bioRxiv - Physiology 2020
Quote:
... UDP-α-D-Glucose and Exendin-4 were from Cayman Chemical. AZ13581837 purchased from AOBIOUS ...
-
No products found
because this supplier's products are not listed.
Takehiro Takahashi, et al.,
bioRxiv - Neuroscience 2021
Quote:
The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
No products found
because this supplier's products are not listed.
Jelena Scekic-Zahirovic, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Brain sections were incubated with the indicated primary antibodies (Rabbit GABAAalpha3 antibody Synaptic Systems, 1:500; Mouse Gephyrin antibody Synaptic Systems, 1:500, Guinea pig VGAT antibody, Synaptic Systems, 1/500) for 48 hours at 4°C followed by secondary antibodies (1:1000 ...
-
No products found
because this supplier's products are not listed.
Michelle S Glossop, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... mCherry antibody 1:1000 (GeneTex), Rb pAb to LaminB1 (Abcam ...
-
No products found
because this supplier's products are not listed.
Inês M.A. Ribeiro, et al.,
bioRxiv - Genetics 2022
Quote:
... with antibodies anti-GFP chicken antibody dilution 1:2000 (Rockland, catalogue # 600-901-215S ...
-
No products found
because this supplier's products are not listed.
Simona Nedelcu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... secondary antibodies (1:200; Vector Laboratories) in PBS with 2% goat serum and detected using a DAB substrate kit (Vector Laboratories) ...
-
No products found
because this supplier's products are not listed.
Yicheng Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... UDP-[6-3H]GlcNAc (ART 1136, American Radiolabeled Chemicals), phosphatidylinositol ...
-
No products found
because this supplier's products are not listed.
Chaochao Dai, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-TNFSF9 (tumor necrosis factor superfamily member 9) (#bs-3851R-APC) was from Bioss (Beijing, China); anti-interleukin (IL)-1β (#12-7018-41 ...
-
No products found
because this supplier's products are not listed.
Jashodeep Datta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... αPD-1 antibody (BioXCell, Clone #BE0273 ...
-
No products found
because this supplier's products are not listed.
Donghui Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Primary antibodies included: anti-TRIM25 polyclonal antibody (1:200; Abclonal), anti-KEAP1 polyclonal antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Nathan D. Lord, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 1:1000 α-GFP antibody (Aves Labs AB_2307313) in antibody binding buffer at 4ºC ...
-
No products found
because this supplier's products are not listed.
Ralph E Peterson, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
Three gerbil families (Meriones unguiculatus, n=6 per family: 2 adults, 4 pups) were used in this study (Charles River). All procedures related to the maintenance and use of animals were approved by the University Animal Welfare Committee at New York University ...
-
No products found
because this supplier's products are not listed.
Fransenio Clark, et al.,
bioRxiv - Immunology 2022
Quote:
The TCR V beta repertoire kit contained antibodies to over 76% of V βeta families (Beckman Coulter, Fullerton, CA). The cells were stained with these antibodies in combination with tetramers or dextramers for 20 minutes at RT to determine the TRBV repertoire of antigen specific cells ...
-
No products found
because this supplier's products are not listed.
R. C. Calizo, et al.,
bioRxiv - Cell Biology 2020
Quote:
3D biochips containing fixed A10 cells were embedded in Embed 812 resin (Electron Microscopy Sciences (EMS), Hatfield ...
-
No products found
because this supplier's products are not listed.
R. Wang, et al.,
bioRxiv - Biophysics 2019
Quote:
Nerve-free Hydra prepared by heat shock treatment of strain A10 and untreated controls were fixed and stained with rhodamine-phalloidin (Biotium, Fremont, CA). The polyps were relaxed in 1 mL of 1 mM linalool (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mehran Najibi, et al.,
bioRxiv - Immunology 2019
Quote:
... Anti-Mucolipin 1 (MCOLN1) (C-Term) antibody (Antibodies-Online, ABIN571446 1:1000).
-
No products found
because this supplier's products are not listed.
Carolyn Marquis, et al.,
bioRxiv - Cell Biology 2020
Quote:
... human anti-centromere antibody (ACA) 1:250 (Antibodies Incorporated) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Peng Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... α-RFP antibody (1:5000) (ChromoTek, α-RFP antibody [6G6]), α-AP2S antibody79 (1:500) ...
-
No products found
because this supplier's products are not listed.
Jingzhang Wei, et al.,
bioRxiv - Immunology 2022
Quote:
... an isotype control antibody was used (1:50 dilution, REA control antibody, Miltenyi Biotec, Germany). Samples were analysed using a flow cytometer (Becton Dickinson FACSCalibur) ...