-
No products found
because this supplier's products are not listed.
Chloe G Myers, et al.,
bioRxiv - Cell Biology 2024
Quote:
... or IGF-1 (25, 50, 100 nM, GroPep Bioreagents), at different doses for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... heparan sulfate (1 μg/mL, Galen Laboratory Supplies). The final medium was comprised of basal media containing human TGF-β2 (2 ng/mL ...
-
No products found
because this supplier's products are not listed.
Ruhi Patel, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plated on solid NGM supplemented with 8 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Laguna Scientific), and incubated for 16 to 24 h at 25° C ...
-
No products found
because this supplier's products are not listed.
Shauni L. Geeraerts, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... washing step and Annexin V (IQ Products IQP-120R, 1:100 in binding buffer) staining for 15 min at RT in the dark ...
-
No products found
because this supplier's products are not listed.
Madhur Kalyan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... tb (0.1ml) were inoculated with 1:1 diluted blood (0.9 ml) in 7ml endotoxin free Sterilin Bijou tubes (Dynalab corporation, USA) and cultured for 4 days at 37ºC with slow shaking at 80 rpm.
-
No products found
because this supplier's products are not listed.
Yann-Ru Lou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:1 v/v) and loaded to the silica gel column (100 g, 200-425 mesh, 60 A, Jade Scientific Inc, Westland, MI, USA) packed with ethyl acetate/hexane (200 mL ...
-
No products found
because this supplier's products are not listed.
Hui-Hsuan Kuo, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 10 μg ml−1 Oryza sativa-derived recombinant human transferrin (Optiferrin, InVitria, 777TRF029-10G,), 14 ng ml−1 sodium selenite (Sigma ...
-
No products found
because this supplier's products are not listed.
Miguel A. Olivencia, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
25-hydroxyvitamin D and testosterone levels were measured in rat citrated plasma and human EDTA plasma using a General 25-Hydroxyvitamin D3 (HVD3) ELISA Kit (Reddot Biotech Inc., Kelowna, Canada) and Testosterone ELISA DE1559 (Demeditec ...
-
No products found
because this supplier's products are not listed.
Joseph Chapman, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and stained with 100 μg/mL EM 2-3 monoclonal antibody (Squarix, SQM003.1) (1:300 in 5% BSA ...
-
No products found
because this supplier's products are not listed.
Silia Ayadi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 10 uL epicoprostanol (100 µg/ml dissolved in cyclohexane; Medical Isotopes Pelham, U.S.A.) as internal standard was added ...
-
No products found
because this supplier's products are not listed.
Maria N Barrachina, et al.,
bioRxiv - Cell Biology 2023
Quote:
... HSPCs were incubated in complete medium containing TPO (50 ng/mL) and recombinant hirudin (100 U/mL, Aniara Diagnostics, RE120A)) for 4 days.42 To assess proplatelet production ...
-
No products found
because this supplier's products are not listed.
Asvin KK Lakkaraju, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1.5 ug plasmid DNA was mixed with 500 ng linearized BAC10:KO1629 DNA (Oxford Expression Technologies Ltd.) and 8 ul Cellfectin™ II reagent (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Angelo D’Alessandro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Lysed RBCs were then mixed 1:1 with Hemoglobind (Biotech Support Group), followed by end over end rotation for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Franz Meitinger, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... AZD1390 (ATMi; 1 μM; Chemgood LLC); Palbociclib (CDK4/6i ...
-
No products found
because this supplier's products are not listed.
Mathieu C. Husser, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and SCR7 (1 μM; Xcess Biosciences) for 4 hours before and 48 hours after nucleofection ...
-
No products found
because this supplier's products are not listed.
Chew Theng Lim, et al.,
bioRxiv - Biochemistry 2021
Quote:
A total of over 5000 chemicals (Sigma, Selleck, Enzo, Tocris, Calbiochem, and Symansis) were obtained from High-Throughput Screening (HTS ...
-
No products found
because this supplier's products are not listed.
Ilaria Carnevale, et al.,
bioRxiv - Biophysics 2019
Quote:
... penicillin (1%) and streptomycin (1%) and cells have been kept in a CO2 incubator (NuAire, Plymouth, MN, USA), at 5% CO2 and 37°C.
-
No products found
because this supplier's products are not listed.
Andrew D. Weems, et al.,
bioRxiv - Cell Biology 2022
Quote:
VitroGel coffins were prepared by embedding MV3 or A375 cells in VitroGel 3D or RGD at 1:1 dilution according to manufacturer’s instructions (TheWell Biosciences, sku # TWG001). Briefly ...
-
No products found
because this supplier's products are not listed.
David M. Hudson, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Electrospray LC-MS/MS was performed on the LTQ XL using a Cogent 4 diamond hydride column (15 cm x 1 mm; Microsolv Technology, 70000-15P-1) eluted at 50 μl min ...
-
No products found
because this supplier's products are not listed.
Niraj Mishra, et al.,
bioRxiv - Microbiology 2019
Quote:
... they were resuspended in FACS-B and filtered through 100 μm nylon meshes (Sefar, ELKO Filtering, 03-100/44) prior to analysis on a flow cytometer (LSR Fortessa X-20 ...
-
No products found
because this supplier's products are not listed.
Paul Batty, et al.,
bioRxiv - Cell Biology 2023
Quote:
... NIPBL was detected using a rat monoclonal antibody (Absea, 010702F01, 1:500). Sororin was detected using a custom rabbit antibody (1:500) ...
-
No products found
because this supplier's products are not listed.
Haichao Guo, et al.,
bioRxiv - Plant Biology 2020
Quote:
... wrapped around the root-shoot junction with L800-D Identi-Plugs foam (Jaece Industries, NY, USA), plugged in a 15 mL conical centrifuge tube (VWR ...
-
No products found
because this supplier's products are not listed.
Megan S. Reich, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The separation of Sr was processed in a 100 µL microcolumn loaded with Sr-spec Resin (100 - 150 µm; Eichrom Technologies, LLC). The matrix was rinsed out using 6 M HNO3 ...
-
No products found
because this supplier's products are not listed.
Scott Birks, et al.,
bioRxiv - Bioengineering 2023
Quote:
... prior to being tagged with a rabbit anti-nesprin2 antibody (1:300; ImmuQuest IQ565). After primary antibody tagging ...
-
No products found
because this supplier's products are not listed.
Morgan L. Pimm, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Coverslips were washed in 1× PBS and mounted in Aquamount (Andwin Scientific, Schaumburg, IL).
-
No products found
because this supplier's products are not listed.
Myriam Ruault, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Cleared lysate was incubated overnight with 1 μL of polyclonal antibody anti-Sir3 (Agro-bio). 50 μL of magnetic beads protein A (NEB ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Thomas A. Desautels, et al.,
bioRxiv - Microbiology 2023
Quote:
... diluted to 50-100 nM in RexxipF buffer (Gyros Protein Technologies). Resulting values were fit to a 4PL model or calculated as area under the curve (AUC ...
-
No products found
because this supplier's products are not listed.
Maria Georgiou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and cultured in mTeSR-1 medium supplemented with 10 uM ROCK inhibitor Y-27632 (Chemdea, CD0141) to form Embryonic Bodies ...
-
No products found
because this supplier's products are not listed.
Fan Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The corresponding secondary antibodies (HRP-conjugated goat anti-rabbit or goat anti-mouse, 1:5000, CoWin Biosciences) were probed for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Naphat Chantaravisoot, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... GSN knockdown experiments were performed using 2’-deoxy-2’-fluoro-D-arabinonucleic acid antisense oligonucleotides (FANA Antisense Oligos; FANA ASOs) against GSN or scrambled control FANA purchased from AUM BioTech.
-
No products found
because this supplier's products are not listed.
Hsiao-Yun Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... then embedded/inserted into paraffin recipient block/negative mold (IHC World; 10*17 Quick Ray mold IW-UM01-1). Empty slots were filled with blank paraffin cores ...
-
No products found
because this supplier's products are not listed.
Deirdre Nolfi-Donegan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... collagen (0-50 μg/ml, Bio/Data Corporation), thrombin enzyme (0.1 U/ml ...
-
No products found
because this supplier's products are not listed.
Emanuel Rognoni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... blocked with 5% BSA/PBS (1 h at room temperature) and stained with the indicated primary antibodies and 5 µM B-CHP (BIO300, 3Helix) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Diana M. Hendrickx, et al.,
bioRxiv - Microbiology 2023
Quote:
... The C18 µcolumn was made by adding two 1 mm pieces of C18 disk (Affinisep AttractSPE™ Disk Bio C18), 200 µl methanol (Hipersolv Chromanorm ...
-
Kaitao Li, et al.,
bioRxiv - Immunology 2023
Quote:
... the silanized coverslips were incubated with 1% w/v lipoic acid polyethylene glycol-succinimidyl ester (Biochempeg: HE039023-3.4K, MW 3400) and 10% w/v monofunctional polyethylene glycol-succinimidyl ester (Biochempeg ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 10μM forward and reverse primers (see Table 1) and 5μL of AzuraView GreenFast qPCR Blue Mix LR (Azura Genomics, AZ2305). Data was analyzed using QuantStudio 5 software (Thermo-Scientific) ...
-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Kunimichi Suzuki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cryo-sectioned coronally at 100 µm thickness and directly mounted on gelatin-coated slides (FD NeuroTechnologies, #PO101) with the help of solution C provided in the kit ...
-
Cat# ACT-IDMWD1,
USD $75.76/ea
Ask
Farhad S. Golzar, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Genome quality and quantity were checked in 1% agarose gels stained with %0.0001 SYBR Safe and measured in a NanoDrop (ACTGene ASP-3700, Alphatech Systems), respectively ...
-
No products found
because this supplier's products are not listed.
Kathleen L. Arnolds, et al.,
bioRxiv - Microbiology 2023
Quote:
Mesocosm experiments were conducted in 3D-printed pots (S. Fig. 1) that have 18 sampling ports which are sealed with neoprene stoppers (Eisco Labs, Victor, NY). A perforated base allows for root development ...
-
No products found
because this supplier's products are not listed.
Bornwell Seemani, et al.,
bioRxiv - Genetics 2024
Quote:
... PCR products were tested for amplification success via gel electrophoresis through a 1% (w/v) agarose gel stained using GelRed (Anatech Instruments PTY LTD). Negative controls were performed in the extraction and amplification steps to assess any potential contamination through a blank containing only buffer ...
-
No products found
because this supplier's products are not listed.
Nika Heijmans, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Reactions were performed in triplicate in a 96×0.2 ml plate (BIOplastics, cat. #AB17500). Thermal cycling reactions included the following stages ...
-
No products found
because this supplier's products are not listed.
Joerg Doellinger, et al.,
bioRxiv - Microbiology 2019
Quote:
Cereulide standard (50 μg/mL in ACN, product ID CX20422) was purchased from Chiralix (Nijmegen, Netherlands) and used to prepare a dilution series ...
-
Cat# LMIZ-061,
100 ug, contact supplier for pricing
Ask
Yu Ji, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... embryos were incubated to 125 µl of cold protease solution [1.25 mg/ml Bacillus Licheniformis protease (Creative Enzymes, NATE0633) and 125 U/ml DNAseI (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Minsuk Kong, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Increasing ratios (multiplicities of incubation ranging from 20 to 150) of SSHELαHER2 (labeled with AlexaFluor647) were incubated with 5 × 105 cells/ml in siliconized tubes (G-tubes, Bio Plas Inc.) for 1 h at 37 °C with gentle inversion ...