-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... day 0 and day 21) with 5 μg/dose of recombinant SARS-CoV-2 Spike protein (S1+S2 extracellular domain) (Bon Opus Biosciences, #BP040) adjuvanted with 100 μg/dose alhydrogel adjuvant 2% (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Robert J. Ju, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Confinement height was controlled using a coverslip containing 3 µm height PDMS micropillars passivated with non-adhesive pLL-PEG (SuSoS). Microtubule stability was assessed via axial confinement of 1205Lu cells endogenously labelled for meGFP-α-Tubulin (CRISPR ...
-
No products found
because this supplier's products are not listed.
Lisa Koshko, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and immediately frozen with liquid nitrogen in screw cap tubes containing 3 mm Zirconium Beads (OPS Diagnostics, BAWZ 3000-300-23). 1 mL TRIzol Reagent (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Hsiao-Wei Tsao, et al.,
bioRxiv - Immunology 2021
Quote:
... The following primary antibodies were used to detect designated proteins: Batf (Brookwood Biomedical, PAB4003), Irf4 (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Tung Dinh, et al.,
bioRxiv - Microbiology 2024
Quote:
... were seeded one day prior to transfection of 2 µg replication competent pNL4-3 plasmid containing WT or mutant INs using HilyMax transfection reagent (Dojindo Molecular Technologies, Inc.) in 1:3 ratio ...
-
No products found
because this supplier's products are not listed.
Leticia R. Q. Souza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the primary antibodies [Non-structural protein 1 from ZIKV (NS1, 1:500, BioFront Technologies, BF1225-06;), Class III β-tubulin (TuJ3 ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Takanori Eguchi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Overexpressed proteins in the chromatin fraction was analyzed by western blotting using anti-MZF1 antibody (Assay Biotechnology) and anti-SCAND1 antibody (ab64828 ...
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... a pooled digest (3 µg of protein from the fifteen 15 µg samples) was applied to an SCX MicroSpin column (The Nest Group, Inc.) according to manufacturer’s instructions and fractionated using 50 mM ...
-
No products found
because this supplier's products are not listed.
Eun Hye Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cells were washed and stained with antibodies against cell surface molecules in PBS containing 4% of human serum (Valley Biomedical). NGFR was detected with a 20 μl per million cells of Alexa Flour 647 conjugated α-NGFR (BD Bioscience) ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
The mammalian thioredoxin reductases (TrxRs) are a family of seleno-cysteine containing pyridine...
Cat# PBCA1015,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... CA) along with 1:1000 dilution of Anti-Membrane Protein (2019-nCoV) Polyclonal Antibody (NCV-M-005, eEnzyme, Gaithersburg, MD) and then immunoprobed with appropriate infrared secondary antibody ...
-
Rabbit polyclonal antibody to Thioredoxin 1
Cat# CPA2199,
200 ul USD $350.0, 100 ul USD $220.0, 30 ul USD $110.0
Ask
Adam R. Bentham, et al.,
bioRxiv - Plant Biology 2023
Quote:
... SDS-PAGE/immunoblot analysis was used to identify proteins in the sample with use of anti-GFP antibody (Cohesion Biosciences) and anti-mRFP antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Zhiyuan Ma, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... containing growth supplements (311-GS, Cell Applications), 1% anti-anti and 1% penicillin/streptomycin.
-
No products found
because this supplier's products are not listed.
Rishi Drolia, et al.,
bioRxiv - Microbiology 2023
Quote:
... agar plates containing selective antimicrobial agents (Neogen). Listeria in the intestinal lumen was assessed in the entire intestinal contents ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rafael M. Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... containing Endothelial Cell Medium Supplement Kit (Cell Biologics). Cells were used between passage 4-8.
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Helene Jahn, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Protein concentration was determined by SDS-PAGE (Coomassie or Fluorescence Protein gel stain (Lamda Biotech)) in comparison with standards ...
-
No products found
because this supplier's products are not listed.
Sharvari Narendra, et al.,
bioRxiv - Neuroscience 2021
Quote:
... containing stainless steel ball-bearing sippers (TD-100, Ancare). Centrifuge tubes were securely held through the metal wire cage lid and presented to mice 2 hours before the dark cycle ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Ping Lv, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The primary antibodies included TMOD4 antibody (CUSABIO, China, CSB-PA609953ESR2HU); HuR antibody (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Laura L Gathercole, et al.,
bioRxiv - Physiology 2021
Quote:
... containing 4.5□g/L glucose (Zen Bio Inc., Durham, NC, USA).
-
No products found
because this supplier's products are not listed.
Kevin B. Weyant, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... biotinylated DNP containing a polyethylene glycol (PEG) linker was purchased from Nanocs, and 1-oleoyl-2-[12-biotinyl(aminododecanoyl)]-sn-glycero-3-phosphocholine (18:1-12:0 biotin PC ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... containing 250 μL 0.1 mm glass cell disruption beads (Scientific Industries, Inc.). Cells were lysed using a Fast Prep-24 5G (MP Biomedicals ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Chen Lior, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human tumor microarrays (TMA) containing samples from patients were purchased from US Biomax Inc ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Deborah L. Gater, et al.,
bioRxiv - Biophysics 2022
Quote:
... Vitamin D binding protein (DBP) was purchased from Athens Research and Vitamin D Binding protein (VDR ...
-
No products found
because this supplier's products are not listed.
Juho Liekkinen, et al.,
bioRxiv - Biophysics 2022
Quote:
... Surfactant proteins were purchased from Seven Hills Bioreagents (Cincinnati, Ohio). The Langmuir trough has ribbons instead of Teflon barriers and allows for a maximum area of 312 cm2 and a minimum of 54 cm2 ...
-
No products found
because this supplier's products are not listed.
Amy Q. Wang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The assay ready plate containing compounds was prepared using an Echo acoustic dispensing instrument (Labcyte) that had 90 nL aliquot of each diluted sample per well ...
-
No products found
because this supplier's products are not listed.
Opeoluwa O. Oyewole, St Patrick Reid,
bioRxiv - Microbiology 2020
Quote:
... and immunoprecipitated using anti-SK2 antibody or an Ig control antibody (ECM Biosciences, Versailles, KY, USA). After a 1 h antibody incubation ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...
-
No products found
because this supplier's products are not listed.
Dennis S. Metselaar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... glial fibrillary acidic protein (GFAP) (1:500; BT46-5002–04, BioTrend), S100 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Daniel Schmitt, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Primary antibody: MAP1LC3B (Nanotools, 0260-100). Secondary antibody ...
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... or B.1.1.529 (Omicron; GISAID ID: EPI_ISL_7358094.2) Spike proteins (21st Century Biochemicals). 106 peripheral blood mononuclear cells well were re-suspended in 100 µL of R10 media supplemented with CD49d monoclonal antibody (1 µg/mL ...
-
No products found
because this supplier's products are not listed.
Arthur Forer, Shotaro Otsuka,
bioRxiv - Cell Biology 2023
Quote:
Gold beads (15 nm) conjugated with Protein A (Cytodiagnostics, Burlington, Ontario, Canada) were absorbed on both sides of the sections as fiducial markers for tomography reconstruction ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...