-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... and TNF (PE rat anti-mouse TNF alpha, 1:100; Invitrogen, Cat. 12-7321-82) for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Xiucui Ma, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse TNF-alpha (R&D Systems, MTA00B), mouse IL-6 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
Takafumi Kabuto, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... a Rat TNF alpha ELISA Kit (ab100785, Abcam), a Rat bFGF ELISA Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Christopher P Saxby, et al.,
bioRxiv - Bioengineering 2023
Quote:
... TNF-alpha (BD, Cat. # 563996), IL-2 (BioLegend ...
-
No products found
because this supplier's products are not listed.
Phillip M Mackie, et al.,
bioRxiv - Neuroscience 2021
Quote:
... TNF-alpha (Biolegend, 502908, PE, 1:100), IL1beta (Biolegend ...
-
No products found
because this supplier's products are not listed.
Nikita P. Patil, et al.,
bioRxiv - Physiology 2022
Quote:
... Tumor necrosis factor alpha (TNF-α, 20 ng/mL; Sigma-Aldrich) and cycloheximide (chx ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat anti-alpha Tubulin (1:500 Bio-Rad), rabbit anti-NudE/NudEL antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Nontawat Chuinsiri, et al.,
bioRxiv - Physiology 2023
Quote:
... TNF-alpha (Merck); mouse monoclonal anti-CaSR (ab19347 ...
-
No products found
because this supplier's products are not listed.
Han-Ming Wu, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... TNF Alpha Polyclonal Antibody (Proteintech, 17590-1-AP), and GAPDH antibody (Proteintech ...
-
No products found
because this supplier's products are not listed.
Kalyn Kono, et al.,
bioRxiv - Cell Biology 2019
Quote:
... anti-alpha-tubulin (rat monoclonal, Santa Cruz). Secondary antibodies used were horseradish peroxidase (HRP)-conjugated anti-mouse antibody (sheep polyclonal ...
-
No products found
because this supplier's products are not listed.
Livnat Jerby-Arnon, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... TNF-alpha (Miltenyi Biotec, Human TNF-α, Cat. No. 130-094-014) IFN-gamma (R&D systems ...
-
No products found
because this supplier's products are not listed.
Masae Heront-Kishi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... with or without the addition of the cytokines TNF-alpha (20 ng/mL, Cell Signaling Technology) and TGF-beta 1 (10 ng/mL ...
-
No products found
because this supplier's products are not listed.
Leopoldo F. M. Machado, Andrew Currin, Neil Dixon,
bioRxiv - Bioengineering 2019
Quote:
... coli DH5-alpha (NEB), transformation for induction test was made into E ...
-
No products found
because this supplier's products are not listed.
Peter F. Renz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
No products found
because this supplier's products are not listed.
Q Escalante-Covarrubias, et al.,
bioRxiv - Physiology 2022
Quote:
... from Alpha Diagnostics International ...
-
No products found
because this supplier's products are not listed.
Sofia Nasif, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... TNFα treatment (25 ng/ml rh TNF-alpha, STEMCELL Technologies) was performed in DMEM without FCS for 20 hours ...
-
No products found
because this supplier's products are not listed.
Juan Ji An, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and alpha-35S-UTP (PerkinElmer #NEG039H250UC). Brain sections were postfixed in 4% paraformaldehyde for 1 h and acetylated for 10 min with 0.1M triethanolamine hydrochloride/0.25% acetic anhydride (pH 8.0) ...
-
No products found
because this supplier's products are not listed.
Jinzi Wu, Yan Dou, Warren C. Ladiges,
bioRxiv - Pathology 2020
Quote:
... TNF-α (Novus Biologicals, NBP1-19532), IL-6 (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Marco Tigano, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... TNF-alpha (200 ng ml−1, Invivogen), IFN-beta (5 ng ml−1 ...
-
No products found
because this supplier's products are not listed.
Alexandra Thiran, et al.,
bioRxiv - Immunology 2023
Quote:
... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
No products found
because this supplier's products are not listed.
Hae Ryong Kwon, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... in alpha MEM (Corning) plus 10% FBS (mesenchymal stem cell-qualified ...
-
No products found
because this supplier's products are not listed.
Merve Sen, et al.,
bioRxiv - Cell Biology 2021
Quote:
... we used heterozygous P23H rats obtained by crossing homozygous RHOP23H rats with RHOWT rats (CDH IGS Rat; Charles River, Germany). Animals were housed in the Institute for Ophthalmic Research animal facility under standard white cyclic lighting ...
-
No products found
because this supplier's products are not listed.
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Mouse TNF-alpha (Sino Biological Inc, 50349-MNAE). IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
No products found
because this supplier's products are not listed.
Jiho Kim, et al.,
bioRxiv - Bioengineering 2023
Quote:
... anti-alpha-SMA (Dako), anti-fibronectin (AbCam ...
-
No products found
because this supplier's products are not listed.
Loïc Duffet, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Rat embryos (E17) obtained from timed-pregnant Wistar rats (Envigo) were used for preparing primary cortical neuronal cultures.
-
No products found
because this supplier's products are not listed.
Hannah A. Pizzato, et al.,
bioRxiv - Immunology 2023
Quote:
... rat IgG2b (BioXCell), CD8 (clone YTS169.4 ...
-
No products found
because this supplier's products are not listed.
Caroline J. Zeiss, et al.,
bioRxiv - Microbiology 2021
Quote:
... Bound rat antibodies were detected with FITC-conjugated goat anti-rat IgG (Jackson ImmunoResearch).
-
No products found
because this supplier's products are not listed.
Ewa Bielczyk-Maczynska, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant human TNF-alpha (PeproTech/VWR) was used at a concentration of 10 ng/ml.
-
No products found
because this supplier's products are not listed.
Carlos Gomez-Diaz, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse TNF (Immunotools, 12343017), cycloheximide (CHX ...
-
No products found
because this supplier's products are not listed.
Hugo Girão, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat anti-RFP (ChromoTek) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Temistocles Molinar Jr., et al.,
bioRxiv - Molecular Biology 2022
Quote:
... alpha-factor peptide (GenScript) was added to a final concentration of 5 µg/ml for 1.5 hours ...
-
No products found
because this supplier's products are not listed.
Florian Gaertner, et al.,
bioRxiv - Immunology 2022
Quote:
... Interferon alpha was measured by ELISA (Mouse IFN Alpha All Subtype ELISA Kit, High Sensitivity, PBL Assay Science). Blood was left at room temperature for 20 min and after centrifugation serum was frozen at -20°C until further analysis ...
-
No products found
because this supplier's products are not listed.
Olivier Thouvenin, et al.,
bioRxiv - Biophysics 2019
Quote:
... and alpha-bungarotoxin (TOCRIS) were injected in the center of the diencephalic ventricle in order to label CSF and paralyze the fish in a single injection ...
-
No products found
because this supplier's products are not listed.
I. Deniz Derman, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Alpha Tubulin (TUBA4A; Origene), and MUC5B (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Iulia Rusu, et al.,
bioRxiv - Immunology 2021
Quote:
... Tnf−/− mice were purchased from Jackson Laboratories (Bar Harbor, MA), X ...
-
No products found
because this supplier's products are not listed.
Kevin R Hughes, et al.,
bioRxiv - Microbiology 2019
Quote:
... and Quantitect murine TNF-R1 primer assay (Qiagen) or hypoxanthine– guanine phosphoribosyltransferase (HPRT ...
-
No products found
because this supplier's products are not listed.
Thai Le,
bioRxiv - Synthetic Biology 2021
Quote:
... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
No products found
because this supplier's products are not listed.
Rachel Lackie, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein expression was quantified using the Alpha Innotech software for the FluoroChemQ chemiluminescent exposure system (Alpha Innotech; GE Healthcare, London, ON, Canada) or ImageLab for ChemiDoc system (BioRad ...
-
No products found
because this supplier's products are not listed.
Tianxiong Yu, et al.,
bioRxiv - Genetics 2019
Quote:
... and rat (Illumina). RNAs longer than 200 nt were selectively recovered using the RNA Clean & Concentrator-5 kit (Zymo Research) ...
-
No products found
because this supplier's products are not listed.
Ramona Jühlen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FADS 1 cells were grown in MEM Alpha (Lonza, Basel, Switzerland) supplemented with 15% FBS and 1% pen/strep ...
-
No products found
because this supplier's products are not listed.
Kristina Vaeth, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-rat-HRP (Dianova). All strains and plasmids used in this study are listed in Suppl ...
-
No products found
because this supplier's products are not listed.
Jhon R. Enterina, et al.,
bioRxiv - Immunology 2021
Quote:
... anti-rat IgG2a-AF488 (SouthernBiotech), and anti-rat IgG2b-AF647 (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Stephanie Veerasammy, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and rat anti-Ki67 (Vector Laboratories, Burlingame ...
-
No products found
because this supplier's products are not listed.
Ya-Lin Lu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... E18 rat cortex (BrainBits®, FSDECX1M) were grown in STEMdiff™Neural Induction Medium (STEMCELL Technologies ...
-
No products found
because this supplier's products are not listed.
Angela Ballesteros, Kenton J. Swartz,
bioRxiv - Neuroscience 2021
Quote:
... we used oil immersion alpha Plan-Apochromat 63X/1.4 Oil Corr M27 objective (Carl Zeiss) and immersol 518F media (ne=1.518 (30°)) ...
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-rat (IRDye® 800 CW Goat anti-Rat IgG [H + L], LI-COR, 925-32219, 1:10.000) and anti-rabbit (IRDye ® 800 CW Goat anti-Rabbit IgG ...
-
No products found
because this supplier's products are not listed.
Andrew R. Morris, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and alpha fodrin/alpha-II spectrin (cat # BML-FG6090-0500, Enzo Life Sciences). Protein bands were visualized using horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG (Abcam ...
-
No products found
because this supplier's products are not listed.
Roberto R. Moraes Barros, et al.,
bioRxiv - Microbiology 2021
Quote:
... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
No products found
because this supplier's products are not listed.
Apurva T. Prabhakar, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... CKII alpha’ Antibody 1:1000 (Bethyl; catalog no. A300-199A).