-
No products found
because this supplier's products are not listed.
Gila Lustig, et al.,
bioRxiv - Microbiology 2019
Quote:
The following protocol was adapted from the μMACS Streptavidin Kit protocol (Miltenyi): 1μg of biotinylated antibodies to CD26 or CD36 (Ancell) were added to 1ml of virus ...
-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Mouse AECs were stained for Muc5b by mouse monoclonal antibody 3AE (27) and rabbit antibody Scgb1a1 (Seven Hills BioReagents WRAB-3950).
-
No products found
because this supplier's products are not listed.
Silvia Pittolo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... before primary antibody mouse α-NET (1:100, MAb Technologies), and secondary antibody goat α-mouse Alexa Fluor 555 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Caroline Haikal, et al.,
bioRxiv - Biochemistry 2021
Quote:
... incubated with 1:20 10 nm gold-anti-mouse antibody (Ted Pella 15751), washed ...
-
The protein Streptavidin is purified from Streptomyces avidinii. Streptavidin binds to biotin...
Cat# 2RD-A1556-YJ,
Inquiry
Ask
Teresita Padilla-Benavides, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The Mouse anti-BRD9 antibody (1H8, CBMAB-0174-YC) was from Creative Biolabs. The Rabbit anti-PBRM (Baf180 ...
-
No products found
because this supplier's products are not listed.
Caterina Ivaldo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and specific secondary antibodies (anti rabbit/anti mouse IgG-HRP, Euroclone S.p.A, Italy). The blotting membranes were reprobed with loading control antibodies ...
-
No products found
because this supplier's products are not listed.
Ali Doğukan Anğın, et al.,
bioRxiv - Pathology 2019
Quote:
... treatment was followed with Streptavidin/HRP complex (SHP125) (ScyTek Laboratories, USA). Diaminobenzidine was used to visualise peroxidase activity in the tissues ...
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Zumu Yi, Yeyu Liu, Jing Wang, Chen Hu, Yi Man,
bioRxiv - Cell Biology 2023
Quote:
... the cell solutions were co-incubated with FITC Goat Anti-Mouse IgG (H+L) Antibody (APExBIO, K1201,1:400) and APC Anti-Rabbit IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Microbiology 2023
Quote:
... or conjugated in-house with X8 antibody-labeling kits (Standard BioTools) and stored at 4°C in Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide ...
-
No products found
because this supplier's products are not listed.
Marion Le Rochais, et al.,
bioRxiv - Immunology 2022
Quote:
... tissues were incubated with a secondary antibody coupled to horseradish peroxidase (Polink-1 HRP for Rabbit & Mouse – GBI Labs Kit / AffiniPure Goat Anti-Rat IgG −112-005-143 ...
-
Streptavidin Antibody is a Rabbit Polyclonal against Streptavidin.
Cat# abx319856-200UG,
200 µg USD $710.5
Ask
M Hazime, et al.,
bioRxiv - Neuroscience 2022
Quote:
GABA concentrations in the extracellular medium of astrocytes was determined using the Mouse GABA ELISA Kit (Abbexa, Ltd.) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Yasuhiro Arimura, et al.,
bioRxiv - Molecular Biology 2024
Quote:
A total of 25 fmol of Absolute Mag streptavidin nanomagnetic beads (CD Bioparticles: WHM-X047) were transferred to a 0.5 mL protein LoBind tube (Eppendorf) and mixed with 200 pmol of inner spacer module protein (biotin-3HB-SPYcatcher003 or biotin-60nm-SAH-SPYcatcher003 ...
-
No products found
because this supplier's products are not listed.
Vikas Arige, et al.,
bioRxiv - Physiology 2022
Quote:
... The IP3R1 antibody (#ARC154, Antibody Research Corporation) was used at 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Bader Al Alwan, et al.,
bioRxiv - Biophysics 2020
Quote:
The fluorescence imaging experiment of CD44 on the MβCD-treated fixed KG1a cells was conducted in a way similar to that on the fixed control KG1a cells by using a combination of the anti-CD44 antibody and the Alexa-Fluor-647-conjugated anti-mouse secondary antibody.22 The cells were injected into poly-L-ornithine-coated microfluidic chambers (ibidi GmbH, sticky-slide VI 0.4) using the syringe pump and incubated overnight at 4°C.
-
No products found
because this supplier's products are not listed.
Alexandria P Eiken, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... protein lysates from OSU-CLL cells (1e6 cells/mL) were clicked to TAMRA biotin-azide and incubated with streptavidin agarose resin (Click Chemistry Tools; Scottsdale, AZ) to isolate biotin-alkyne-tagged proteins ...
-
No products found
because this supplier's products are not listed.
Martin Privat, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the primary antibody used was a rabbit anti-GFP antibody (TP401, Torrey pines biolabs) diluted 1:1000 in blocking buffer for overnight incubation ...
-
No products found
because this supplier's products are not listed.
Xiyuan Bai, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-CTLA-4 neutralizing antibody and non-immune human IgG antibody were purchased from BPS Bioscience Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Daniel J. Rawle, et al.,
bioRxiv - Immunology 2021
Quote:
Mouse serum was collected in Microvette 500 Z gel tubes (Sarstedt) with GzmA levels determined using a GzmA ELISA kit (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Chrysa Koukorava, et al.,
bioRxiv - Cell Biology 2023
Quote:
... including optimized mouse primers (Supplementary Table 1) on a ViiA7 (Thermofisher/ABI). Cycles consisted of an initial incubation at 50° C and 95° C for 2 and 10 minutes respectively ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Melina Krautwurst, et al.,
bioRxiv - Genomics 2023
Quote:
... and the corresponding chemical kit (SCIEX). The peak scoring was done with the provided software (GenomeLab ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Easy-BLUETM RNA isolation kit (iNtRON Biotechnology) was used for total RNA extraction following the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
No products found
because this supplier's products are not listed.
Yoko Shibata, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the clarified supernatant was incubated with streptavidin agarose resin (GoldBio), eluted in buffer containing 5 mM biotin ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...
-
No products found
because this supplier's products are not listed.
R Barbieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... the paraffin sections were incubated with anti-glycophorin A antibody JC 159 (Mouse Monoclonal Antibody, ref: Mob 066-05, Diagnostic BioSystems, Nanterre, France) at a 1/500 dilution using a Ventana Benchmark autostainer (Ventana Medical Systems ...
-
Cat# HY-136179-10 mM * 1 mL,
10 mM * 1 mL, USD $198.0
Ask
Longxi Zhou, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The biotinylated probes were first incubated with Streptavidin Magnetic Beads (MedChemExpress, HY-K0208) in Buffer I (1 M NaCl ...
-
No products found
because this supplier's products are not listed.
Fan Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The corresponding secondary antibodies (HRP-conjugated goat anti-rabbit or goat anti-mouse, 1:5000, CoWin Biosciences) were probed for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Erminia Donnarumma, et al.,
bioRxiv - Physiology 2021
Quote:
A mouse ELISA kit was used to compare serum levels of cardiac troponin I (cTnI, Life Diagnostics) and cardiac myosin light chain 1 (MLC1 ...
-
No products found
because this supplier's products are not listed.
Samuel M. Duncan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Any unbound streptavidin-binding sites were blocked by a 1 min dip into 10 mg/mL biocytin (Tocris). Each set of biosensors was incubated with 25 nM solutions of IgG2 mAb139 in 1 x phosphate buffered saline in 6 min association/disassociation cycles ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Lauren T. Gill, et al.,
bioRxiv - Biochemistry 2022
Quote:
... except for an ubiquitin specific primary antibody (1:1000 dilution; UBCJ2, Mono- and polyubiquinated conjugates monoclonal antibody, FroggaBio).
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... and PACT Premier screening kits (Molecular Dimensions). Crystals were not obtained for the Endo H-treated enzyme ...
-
No products found
because this supplier's products are not listed.
Giovanny J. Martínez-Colón, et al.,
bioRxiv - Immunology 2021
Quote:
... n2019-nCoV (Biosearch technologies, KIT-NCOV-PP1-1000). For subgenomic N-gene quantification ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...