-
No products found
because this supplier's products are not listed.
Volha Liaudanskaya, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Anti-Anti (1%) from Sciencell research laboratories (cat.no ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Takeshi Katsuda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1× antibiotics (anti-anti (Thermo) or gentamycin (Gemini Bio-Products)) ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Fatima Amer-Sarsour, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-α-Fetoprotein (ScyTek A00058); rabbit anti-α-smooth muscle actin (Abcam 32575) ...
-
No products found
because this supplier's products are not listed.
Erick X. Pérez-Guzmán, et al.,
bioRxiv - Microbiology 2019
Quote:
... anti-ZIKV IgG (XPressBio, Frederick, MD, USA) at baseline ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Thomas Germe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for 10 min before incubating at 4°C overnight with monoclonal antibody (either anti-GyrA-CTD – 4D3 or anti-GyrB-CTD – 9G8; a gift from Alison Howells, Inspiralis) diluted 1/1000 in TBS-T 5% milk ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Daiana Martire-Greco, et al.,
bioRxiv - Immunology 2021
Quote:
... conditioned media (CM) were collected and incubated for 2 h with an anti-Stx antibody (anti-Stx2 variant from Toxin Technology, USA) to block the direct effect of Stx ...
-
No products found
because this supplier's products are not listed.
Chafen Lu, et al.,
bioRxiv - Microbiology 2019
Quote:
... Secondary antibodies were rabbit polyclonal anti-His (Delta Biolabs), Horseradish peroxidase (HRP)-anti-rabbit and HRP-anti-mouse IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Yu Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were then incubated with rabbit anti-CRF (1:2,000, Bachem, T4037) primary antibody in PBS containing 0.3% Triton X-100 overnight or for 36 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Priyamvada Acharya, et al.,
bioRxiv - Immunology 2020
Quote:
... were captured using mouse anti-AVI-tag mAb (Avidity LLC, Aurora, CO). In brief ...
-
No products found
because this supplier's products are not listed.
Hannah A. Pizzato, et al.,
bioRxiv - Immunology 2023
Quote:
CHO cells were incubated with 1µg/mL anti-CHO antibody (Cygnus Technologies) for 30min at 4°C ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
A compound library including 315 approved anti-cancer drugs was purchased from TargetMol (L2110 ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Membranes were overnight probed in 1/1000 Rabbit Anti-Human APOBEC3G (Immunodiagnostics Inc.), washed three times ...
-
No products found
because this supplier's products are not listed.
Giulia I. Corsi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
Oocysts were purified by immunomagnetic separation (IMS) using the Dynabeads anti-Cryptosporidium kit (IDEXX), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
Lucy Ngo, et al.,
bioRxiv - Systems Biology 2019
Quote:
▪ Lint free cotton swab with anti-static handle (Puritan Medical Products, SKU#: 876-PPC)
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Xiyuan Bai, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-CTLA-4 neutralizing antibody and non-immune human IgG antibody were purchased from BPS Bioscience Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Francesca Pischedda, et al.,
bioRxiv - Neuroscience 2020
Quote:
Affinity-purified anti-P-Thr645-NSF polyclonal antibody was made in a NZW female rabbit (Envigo) by immunization against a single peptide (amino acids 631–656 ...
-
No products found
because this supplier's products are not listed.
Rodney M. Ritzel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were mounted onto glass slides with coverslips using an anti-fade Hydromount solution (National Diagnostics). The following primary and secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Frederike Klimm, Thomas Speck, Marc Thielen,
bioRxiv - Plant Biology 2023
Quote:
... by using the primary antibody LM6 ([Anti-1,5-α-L-Arabinan] Antibody, Megazyme Ltd, Bray, Ireland) and a fluorescent marker (Alexa Fluor 568 goat anti-rat IgG (H+L) ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Jorge Lascano, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Plates were washed and samples incubated with rabbit anti-human NE (Athens Research and Technology, Athens, GA) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Maria Zhivagui, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Immunofluorescence staining was carried out using anti-cyclobutane pyrimidine dimers (CPDs) monoclonal antibodies (clone KTM53, Kamiya Biomedical) and anti-6-4 photoproducts monoclonal antibodies (Clone 64M-2 ...
-
No products found
because this supplier's products are not listed.
Minxiao Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies used for co-staining were rabbit-anti-Gramd2 (1:100, ATLAS biological, CAS #HPA 029435), rabbit-anti-Sftpc (1:300 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Thomas T. Thomsen, et al.,
bioRxiv - Microbiology 2021
Quote:
... ∼200 µL blood from the jaw/cheek was collected in Eppendorf tubes with anti-coagulate (Sarstedt, Nümbrecht, Germany). Peritoneal lavage was performed by injecting 2.0 ml of sterile physiological saline IP ...
-
No products found
because this supplier's products are not listed.
Kartikeya Vijayasimha, et al.,
bioRxiv - Immunology 2022
Quote:
... Transfected cells were allowed to recover for two days and were then labelled at 4°C with anti-Thy1.1 antibody (clone HIS51, eBiosciences) for 30 minutes in PBS buffer containing 0.1% BSA (Amresco). Cells were then washed in buffer and incubated with anti-mouse IgG microbeads beads (Miltenyi Biotech ...
-
No products found
because this supplier's products are not listed.
Ben Nicholas, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 mg of anti-MHC-I mouse monoclonal antibodies (W6/32) covalently conjugated to Protein A sepharose (Repligen) using DMP as previously described [42,43] were added to the clarified supernatants and incubated with constant agitation for 2 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
José M. Duhart, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 0.93% v/v propionic acid and 0.25% v/v tegosept (anti-fungal agent, Genesee Scientific, El Cajon, CA). Flies were raised at 25°C except where noted ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).
-
No products found
because this supplier's products are not listed.
Jacqueline M. Tokarew, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 0.4 % horseradish peroxidase solution was prepared using HRP-linked anti-rabbit secondary antibody diluted in Stabilizyme solution (SurModics SZ02). Each read was set up in triplicate on a white polystyrene 96-well plate (ThermoFisher 236105 ...
-
Sheep polyclonal antibody raised against Cytomegalovirus pentamer protein, purified by Protein G...
Cat# AbCMV2450-500,
500µg USD $310.0
Ask
Jiarui Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... wild type cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM CF568-labled gRNA FISH probes and 1:500 anti-Spike antibodies (Cat# PAB21477-500, The Native Antigen Company) for 4 hours in the dark ...
-
No products found
because this supplier's products are not listed.
Xiaopeng Tang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... FXa-AT-III complex was detected by incubation with HRP-conjugated anti-human AT-III antibody (1: 200, SAAT-APHRP, Enzyme Research Laboratory, USA). Relative level of TAT and FXa-AT-III complex was calculated.