-
No products found
because this supplier's products are not listed.
Xiaowei Zheng, et al.,
bioRxiv - Cell Biology 2021
Quote:
... or anti-α-tubulin (1:1000, MAB11106; Abnova) antibodies in TBS buffer containing 1% nonfat milk ...
-
No products found
because this supplier's products are not listed.
Marissa Co, et al.,
bioRxiv - Neuroscience 2019
Quote:
... goat α-tdTomato (#LS-C340696, LifeSpan BioSciences, 1:500), mouse a-TLE4 (#sc-365406 ...
-
No products found
because this supplier's products are not listed.
Piergiorgio La Rosa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... α-GAPDH (1:5000, cat #E-AB-20059, Elabscience) in TBS containing 0.1% Tween-20 and 5% BSA ...
-
No products found
because this supplier's products are not listed.
Grayson Sipe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... α-rabbit α-SST-14 (1:500, T-4103, Peninsula Labs), mouse α-PV (1:500 ...
-
No products found
because this supplier's products are not listed.
Kailu Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... S-expressing and ACE2 cells or α-fragment and ω-fragment cells were then mixed in a 96-well plate (Greiner bio-one) to initiate cell-cell fusion at 37°C for 2 hr ...
-
No products found
because this supplier's products are not listed.
Monica Chandra, et al.,
bioRxiv - Microbiology 2022
Quote:
... Monoclonal α-GPEET and α-EP IgG (Cedarlane Labs) were used in 1:50 antibody to cells volume as the primary staining ...
-
No products found
because this supplier's products are not listed.
Ik-Jung Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... or anti-SARS-CoV-2 human sera (1:100 dilution) (COVID-19 negative, RayBiotech, Cat #:CoV-VP1-S-100) (COVID-19 convalescent, Innovative Research, Cat #: ISERSCOV2P100UL) (Vaccinated, RayBiotech, Cat #: CoV-VP1-S-100, CoV-VM1-S-100) (Supplementary Table 1) ...
-
Chromatographically purified according to Drapeau et.al, J. Biol. Chem., 247, 6720 (1972)....
Cat# LS02126,
5x10 ug, $192.00
Ask
Ana Curinha, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After enzymatic digestion (DMEM GlutaMAX, 1% P/S, 3% papain [Worthington 3126] ...
-
No products found
because this supplier's products are not listed.
Erin E. Henninger, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... α factor (Bachem) was added to a final concentration of 10-7 M and cultures were incubated for 130 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Chuchu Wang, et al.,
bioRxiv - Biophysics 2024
Quote:
... 15N isotope-labeled Ac-α-syn or α-syn were produced in M9 minimal medium with uniformly labeled 15NH4Cl (1 g/L, Cambridge Isotope Laboratories). Not isotope-labeled Ac-α-syn or α-syn were produced in LB medium ...
-
No products found
because this supplier's products are not listed.
Masakazu Iwai, et al.,
bioRxiv - Plant Biology 2020
Quote:
... at 2.0 mg Chl/mL and solubilized with 4% (w/v) n-dodecyl-α-D-maltoside (α-DDM as previously abbreviated as α-DM; Anatrace) for 30 min with gentle agitation on ice ...
-
No products found
because this supplier's products are not listed.
R. J. Elsworthy, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and sAβPP-α (MyBioSource, MBS9358454) in CM was measured via ELISA according to manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Nayara C. Leite, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Oxygen uptake was recorded at 1-s intervals using specific METABOLISM software (Panlab/Harvard Apparatus) coupled with the gas analyser system ...
-
No products found
because this supplier's products are not listed.
Santi Bhattarai-Kline, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 25 μg/mL spectinomycin (GoldBio S-140), 100 μg/mL carbenicillin (GoldBio C-103) ...
-
No products found
because this supplier's products are not listed.
Nanami Morooka, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... cDNA was fragmented with a Covaris S 220 instrument (Covaris). Libraries for RNA-Seq were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Yetis Gultekin, Hermann Steller,
bioRxiv - Developmental Biology 2019
Quote:
... α-PAR (1/1000, Trevigen) and α-Axin (Feng et al. ...
-
No products found
because this supplier's products are not listed.
Arseny Finkelstein, et al.,
bioRxiv - Neuroscience 2019
Quote:
The initial state C(0) was set to α × I with α = 1 (Sussillo and Abbott, 2009), I is the identity matrix ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
because this supplier's products are not listed.
Monique Merchant, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cells were transferred to PBS supplemented with 2.5 mM BMP (18:1(S,S) Bis(Monoacylglycero)Phosphate (BMP); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Lucas Alves Neubus Claus, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and α-BAK1 (1/5,000; custom-made by Eurogentec). For the uncropped blots see Figure S3.
-
No products found
because this supplier's products are not listed.
Eike K. Mahlandt, et al.,
bioRxiv - Cell Biology 2021
Quote:
... BOECs were stimulated with 1 U/ml human α-thrombin (HCT-0020, Haematologic technologies) diluted in phosphate-buffered saline.
-
(S)-(−)-α-Methylbenzylamine is a chiral auxiliary in the enantiodivergent synthesis of simple...
Cat# S6260, SKU# S6260-25ul,
25ul, $97.00
Ask
Changfu Yao, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Pifthrin-α (Selleck Chemicals, S2929) was administered by intraperitoneal injection at a dose of 3mg/kg or vehicle control every other day 1 week after tamoxifen treatment until collection at 6 weeks post-tamoxifen treatment time point ...
-
Cat# HY-13941-50 mg,
50 mg, USD $637.0
Ask
Mina Ogawa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3μM R and S-VX445 (MedChemExpress), 0.5μM AC1 (X281602) ...
-
No products found
because this supplier's products are not listed.
Anastasiya Klebanovych, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Time-lapse sequences were collected in seven optical slices (0.1 μm steps) for 1 min at 1 s interval with the Andor Dragonfly 503 spinning disc confocal system (Oxford Instruments, Abingdon, UK) equipped with a stage top microscopy incubator (Okolab ...
-
No products found
because this supplier's products are not listed.
Idil Ulengin-Talkish, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3 μg/ml blasticidin S Hydrochloride (RPI) and induced with 10ng/ml doxycycline (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Zane G. Moreland, et al.,
bioRxiv - Cell Biology 2021
Quote:
... sputter-coated with platinum (Q150R S, Quorum Technologies) and visualised with a scanning electron microscope (JSM-6010LV ...
-
No products found
because this supplier's products are not listed.
Caio Tabata Fukushima, et al.,
bioRxiv - Biochemistry 2023
Quote:
... followed by homogenization (IKA Tissumizer, 21,000 rpm, 10 s.), a further 3 min ...
-
No products found
because this supplier's products are not listed.
Denisa Baci, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 1% P/S (Euroclone), at 37°C ...
-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
... and (S,S) bisoleoyl-lysobisphosphatidic acid (LBPA, Echelon Biosciences) was prepared at 10 mM in SEC buffer with 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Cole S. Sitron, et al.,
bioRxiv - Cell Biology 2019
Quote:
... or 1:1000 rabbit α-RFP (AB233, Evrogen, Moscow, Russia). The following secondary antibodies were then used at 1:5000 dilution ...
-
No products found
because this supplier's products are not listed.
Brennan J. Sullivan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit α-phospho-KCC2-S940 (1:1000 Aviva Systems Biology), rabbit α-phospho-KCC2-T1007 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Susanne G. van der Grein, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit-α-LC3 (1:1000, polyclonal; MBL international, Woburn, MA), and mouse-α-GAPDH (1:2000 ...
-
No products found
because this supplier's products are not listed.
Georgios Kotsaris, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1% Penicillin Steptomycin (P/S) solution (PAN Biotech, 10.000 U/ml) and 2,5 mg/ml Collagenase A (Roche ...
-
No products found
because this supplier's products are not listed.
Jasmin Dülfer, et al.,
bioRxiv - Biophysics 2020
Quote:
... and HBGA B trisaccharide (α-D-Gal-(1,3)-[α-L-Fuc-(1,2)]-β-D-Gal-(1,O)-CH3) were purchased from Carbosynth.
-
No products found
because this supplier's products are not listed.
Ilhan Tomris, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... using α-strep-tag mouse antibodies 1:3000 (IBA Life Sciences). Subsequently ...
-
No products found
because this supplier's products are not listed.
Xiaofeng Zheng, et al.,
bioRxiv - Biochemistry 2021
Quote:
... S-palmitoylation assay was then performed using CAPTUREome™ S-Palmitoylated Protein Kit (Badrilla) in accordance with manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Alexander N. Malyavko, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... stained with Ponceau S (Amresco), and blocked in 5% BSA ...
-
No products found
because this supplier's products are not listed.
Etienne Côme, et al.,
bioRxiv - Neuroscience 2022
Quote:
... S-MCPG (250 µM; HelloBio), Kynurenic acid (1 mM ...
-
LC Laboratories' Product Number C-8999 - Cabozantinib, S-Malate Salt (BMS-907351, Cometriq,...
Cat# C-8999, SKU# C-8999_25mg,
25 mg, $42.00
Ask
Pooja Sharma, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... SB 203580 (#S-3400) and SB 202190 (S-1700) were from LC Laboratories (Woburn, MA); Okadaic Acid (459616 ...
-
No products found
because this supplier's products are not listed.
Jonathan B. Lynch, et al.,
bioRxiv - Biophysics 2021
Quote:
... at 33 frames s−1 rate with a Cascade 512B EMCCD camera (Photometrics, Tucson, AZ). FM4-64 was excited at 532 nm (~ 10% laser power ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
S. boulardii (S. cerevisiae ATCC® MYA796™) was obtained from American Type Culture Collection (ATCC). The strains created in this study are listed in Supplementary Table S5 ...
-
No products found
because this supplier's products are not listed.
Raquel Martínez-López, et al.,
bioRxiv - Microbiology 2020
Quote:
... TNF-α and IL-10 (Immunotools), and according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Saishree Badrinarayanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The following primary antibodies were used: 1:500 rb-α-VIP Immunostar 722001/20077 (ImmunoStar, Dietzenbach, Germany), 1:500 Ms-α-PV PARV-19 monoclonal P3088 (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Niyati Jhaveri, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... S and G blockers (Akoya Biosciences, MA, #7000008). Samples were first allowed to equilibrate to room temperature in Staining Buffer for 20-30 minutes ...
-
No products found
because this supplier's products are not listed.
Debajit Dey, et al.,
bioRxiv - Biophysics 2023
Quote:
BLI assays with biotinylated S peptides from Biomatik and purified coatomer WD40 domains were carried out as described 34 ...
-
No products found
because this supplier's products are not listed.
Karine Bourgade, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Pre-treatments included mixing Aβ42-HiLyteFluor-555 with 1 μg of blocking antibodies (α-Aβ42-Ab, Anaspec, Fremont, CA) for 15 min at room temperature prior to adding viral particles or pretreating the HSV-1-gB-GFP for 30 min at room temperature with 1% NP40 to disrupt the viral envelope ...
-
No products found
because this supplier's products are not listed.
Anezia Kourkoulou, et al.,
bioRxiv - Genetics 2019
Quote:
... according to the manufacturer‟s instructions (Macherey-Nagel, Lab Supplies Scientific SA, Hellas). Standard PCR reactions were performed using KAPATaq DNA polymerase (Kapa Biosystems) ...
-
No products found
because this supplier's products are not listed.
Einar Eftestøl, et al.,
bioRxiv - Physiology 2021
Quote:
... The electrodes were connected to a pulse generator (Pulsar 6bp-a/s; FHC).
-
No products found
because this supplier's products are not listed.
David S. Booth, Nicole King,
bioRxiv - Evolutionary Biology 2020
Quote:
... the fixed cells were thoroughly homogenized by vortexing for 10 s and then pipetted up and down before transfer into a chamber of a Smart Slide (ibidi USA ...
-
No products found
because this supplier's products are not listed.
David B. Kastner, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...