-
No products found
because this supplier's products are not listed.
Jiuzhi Xu, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Nucleoprotein was isolated from cells using a nucleoprotein extraction kit (AR0106, Bosterbio, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hongyan Sui, et al.,
bioRxiv - Immunology 2019
Quote:
HSV-1 (MacIntyre strain) and Sendai virus (SeV) were obtained from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Robin Anger, et al.,
bioRxiv - Microbiology 2023
Quote:
... while strain BTH101 (Euromedex) – a non-reverting cya mutant – was used in BACTH assays29 ...
-
No products found
because this supplier's products are not listed.
Jian Hang Lam, et al.,
bioRxiv - Immunology 2022
Quote:
... with Trans IT-Virus GEN (Mirus). In brief ...
-
No products found
because this supplier's products are not listed.
Jogindra Naik, et al.,
bioRxiv - Plant Biology 2023
Quote:
... tumefaciens strain GV3101 (pMP90) (GoldBio) and subsequently infiltrated using a syringe into the abaxial side of N ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
Recombinant Antigen
Cat# REC31668-100,
100µg USD $410.0
Ask
Subhasis Mahari, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Human Immunodeficiency Virus (HIV) and Avian Influenza Virus (AIV) Ag were obtained from The Native Antigen Company (Oxford, UK). Aurdino software has been used in the in-house built device and the hardware include a printed Circuit Board (PCB) ...
-
No products found
because this supplier's products are not listed.
Takunori Minegishi, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 0.04% F-127 (AAT Bioquest) diluted in the culture medium for 1 h at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Giovanni S. Offeddu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Primary TCs were obtained from Amsbio (#MBE-F-TM and #MLE-F-TM) and cultured in Mammary Epithelial Cell Growth Medium (#C-21010, Promocell). Human umbilical vein ECs (HUVECs ...
-
No products found
Valeriy M. Paramonov, et al.,
bioRxiv - Microbiology 2020
Quote:
... FSK was from LC laboratories (#F-9929) and kept aliquoted (10 mM ...
-
No products found
because this supplier's products are not listed.
Prachiti Moghe, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Primary antibodies against NANOG (ReproCell, RCAB002P-F), PKCλ (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or bisphenol F (BPF; #A11471, Alfa Aesar, ≥98 %) in 10 mL of corn oil (#405435000 ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The virus titers were measured by flow cytometry assay (Expression Systems).
-
No products found
because this supplier's products are not listed.
Hejun Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... HRP-conjugated F(ab’)2 anti-rabbit IgG (Dianova) was used to confirm the presence of immobilized antigens.
-
No products found
because this supplier's products are not listed.
Paul K. LaFosse, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Virus was injected unilaterally with a stereotactic syringe pump (Stoelting; Wood Dale, IL) through a pulled glass pipette tip cut to an opening of 10–15 μm diameter ...
-
No products found
because this supplier's products are not listed.
Xiaoyu Yu, et al.,
bioRxiv - Biophysics 2022
Quote:
... F-actin was stained with Phalloidin (Solarbio, Product # CA1610, 1:100). To observe the microstructure of the microcylinder structure ...
-
No products found
because this supplier's products are not listed.
Deborah D. Chin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dried samples were imaged on JEM 2100-F (JEOL Ltd., Tokyo, Japan).
-
No products found
because this supplier's products are not listed.
RZ Moger-Reischer, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... We quantified the abundance of each strain using either our Novocyte flow cytometer (ACEA Biosciences) or an LSR II flow cytometer (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Dan Israel Zavala Vargas, et al.,
bioRxiv - Biochemistry 2022
Quote:
... coli SoluBL21 strain (Genlantis) into inclusion bodies (IB) ...
-
No products found
because this supplier's products are not listed.
Elisabet Bjånes, et al.,
bioRxiv - Microbiology 2024
Quote:
... coli strain MC1061 (MClab) grown in LB medium at 37°C with aeration ...
-
No products found
because this supplier's products are not listed.
The Nhu Nguyen, et al.,
bioRxiv - Microbiology 2023
Quote:
Antibody responses against IAV-S nucleoprotein (NP) were measured by using a commercial blocking ELISA (IDEXX, Montpellier, France), following the manufacturer’s recommendation ...
-
No products found
because this supplier's products are not listed.
Jason Neidleman, et al.,
bioRxiv - Immunology 2020
Quote:
... or Influenza Virus Control Peptide Pool (Anaspec). As a positive control for cytokine detection ...
-
No products found
because this supplier's products are not listed.
Šimon Borna, et al.,
bioRxiv - Immunology 2022
Quote:
... and AAV6 virus (Signagen laboratories, and in house produced (33))-mediated delivery of homologous template containing NGFR reporter gene under control of PGK promoter as described previously (33) ...
-
No products found
because this supplier's products are not listed.
Stuti Mehta, et al.,
bioRxiv - Molecular Biology 2022
Quote:
AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
No products found
because this supplier's products are not listed.
Walker D. Short, et al.,
bioRxiv - Molecular Biology 2023
Quote:
A mechanical strain device (FX3000, Flexcell International Corp.) was used to apply cellular strain to murine FFB and AFB to determine the effect of mechanical tension on their HA production and fibrotic phenotype ...
-
No products found
because this supplier's products are not listed.
Paeton L. Wantuch, et al.,
bioRxiv - Immunology 2023
Quote:
... coli O8:K8:H4 (SSI Diagnostica, Strain 81841) in two fragments using primer pairs O3_1F/O5_1R and O5_2F/O3_2R ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
D. Zabelskii, et al.,
bioRxiv - Biophysics 2020
Quote:
... coli cells of strain C41 (StabyCodon T7, Eurogentec, Belgium) were transformed with the expression plasmid ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... coli strains were grown in Lysogeny Broth (LB) (Amresco), while S ...
-
No products found
because this supplier's products are not listed.
Joshua M. Peters, et al.,
bioRxiv - Immunology 2023
Quote:
BCG Danish Strain 1331 (Statens Serum Institut, Copenhagen, Denmark) was expanded ...
-
No products found
because this supplier's products are not listed.
Jenny Samphire, et al.,
bioRxiv - Microbiology 2021
Quote:
... All four strains were grown on Nutrient agar/broth (Neogen) at 37°C overnight (18-20 h ...
-
No products found
because this supplier's products are not listed.
Jeffrey M. Boyd, et al.,
bioRxiv - Microbiology 2023
Quote:
... The strain was confirmed by sequencing performed by Eton Biosciences.
-
No products found
because this supplier's products are not listed.
Tomas Duminis, et al.,
bioRxiv - Biophysics 2020
Quote:
... and examined using SEM (FEI Inspect F, Oxford Instruments, UK) under a 5KV.
-
No products found
because this supplier's products are not listed.
Ryan J. Tomm, et al.,
bioRxiv - Neuroscience 2021
Quote:
... F Treatment with ABI (Sham+ABI and GDX+ABI pooled) reduced the number of overall errors ...
-
No products found
because this supplier's products are not listed.
Sylvia Varland, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Yeast strains were grown in SD-Ura medium (Sunrise Science Products) at 30°C ...
-
No products found
because this supplier's products are not listed.
Kar Ling Hoh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6a,f with ChromoTek RFP-Trap magnetic beads (Proteintech, IL, USA). Samples were resuspended in SDS-loading buffer and subjected SDS-PAGE and western blotting probed by rabbit anti-GFP ...
-
No products found
because this supplier's products are not listed.
Lorena Cascarano, et al.,
bioRxiv - Physiology 2024
Quote:
... Fat - High-Sucrose (F-HS) diet (Research diets, New Brunswick, USA). The compositions of the diets are detailed in Table 1 ...
-
No products found
because this supplier's products are not listed.
Shravanthi Rajasekar, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A549 cells were cultured in F-12K media (Cedarlane Labs, Cat# 302004) supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Andrii Slonchak, et al.,
bioRxiv - Microbiology 2021
Quote:
... Virus replication foci were counted using the Image Studio Lite software (v5.2.5, LI-COR, USA), and titres were determined based on dilution factors and expressed as focus forming units per mL (FFU mL^−1).
-
No products found
because this supplier's products are not listed.
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
... Human Anti-SARS-CoV-2 Virus Spike 1 [S1] IgG ELISA Kit (Alpha Diagnostic Intl. Inc.), against S1 subunit spike protein ...
-
No products found
because this supplier's products are not listed.
Yukihiro Kubota, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and spr-1(ok2144) strains using the TRI Regent (Molecular Research Center, Inc., Cincinnati, OH). Following DNA digestion ...
-
No products found
because this supplier's products are not listed.
Nicholas A. Pudlo, et al.,
bioRxiv - Microbiology 2021
Quote:
All strains were routinely grown in an anaerobic chamber (Coy Lab Products, Grass Lake, MI) at 37°C under an atmosphere of 5% H2 ...
-
No products found
because this supplier's products are not listed.
Shumpei Horii, et al.,
bioRxiv - Microbiology 2022
Quote:
Avermectin production using strain MA-4680T was measured using an LC/MS spectra (AB Sciex TripleTOF 5600+ System ...
-
No products found
because this supplier's products are not listed.
Gila Lustig, et al.,
bioRxiv - Microbiology 2019
Quote:
... Supernatant containing released virus was harvested two days post-transfection and filtered through a 0.45 micron filter(GVS) and stored in 0.5ml aliqouts at −80°C ...
-
No products found
because this supplier's products are not listed.
Yoshiaki Nishimura, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were grown to ~90% confluency in a 96-well plate prior to addition of serially diluted virus to achieve luminescence signals of 30,000-1,000,000 (BMG Labtech PolarStar Optima plate reader at maximum gain) ...
-
No products found
because this supplier's products are not listed.
Caitlin Armstrong, et al.,
bioRxiv - Cell Biology 2019
Quote:
Indirect immunofluorescence using fluorescein-conjugated wheat germ agglutinin (F-WGA, Vector Laboratories, Burlingame, CA, USA) as a counterstain on paraformaldehyde-fixed/sucrose-dehydrated/optimal cutting temperature compound (OCT)-embedded frozen tissue sections was performed as previously described ...
-
No products found
because this supplier's products are not listed.
Kai Bi, et al.,
bioRxiv - Microbiology 2020
Quote:
... The transgenic fungal strains were cultured on PDA amended with 100 μg/ml hygromycin B (Calbiochem) and/or 100 μg/ml Nourseothricin (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
JF Sturgill, et al.,
bioRxiv - Neuroscience 2020
Quote:
... AAV virus (300nL volume) was then pressure injected 100nL/min via a glass pipette pulled (P-97 Sutter Instruments) from borosilicate capillaries (Drummond calibrated 5ul ...
-
No products found
because this supplier's products are not listed.
Miroslav Homola, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The purified virus was applied onto glow-discharged electron microscopy grids covered with holey carbon (Quantifoil, SPT Labtech, Melbourn, UK), blotted ...