-
No products found
because this supplier's products are not listed.
Maria Körner, et al.,
bioRxiv - Cell Biology 2023
Quote:
Pulldown assays using immobilized GST fusion proteins or biotinylated peptide (Biotin- CQGLYFHINQTLREAHFHSLQHRG-COOH; PANATecs GmbH, Tübingen, Germany) were essentially performed as described (Böhm et al ...
-
No products found
because this supplier's products are not listed.
Tomoki Togashi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... hPC antigen (hPC:Ag) was measured using the Human Protein C AssayMaxTM ELISA Kit (Assaypro, St. Charles, MO) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Julie Wells, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The left lung lobe of each mouse was fixed in neutral buffered formalin (Labchem, Inc. Pittsburgh, PA) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
CP Profaci, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Three hours after CNO injection the mice were live-decapitated using a mouse decapitator (LabScientific, XM-801) and brain endothelial cells were isolated for RNA sequencing.
-
No products found
because this supplier's products are not listed.
Hammam Antar, et al.,
bioRxiv - Biochemistry 2021
Quote:
... CTP/parSDNA 40 pre-mix (10 μL) was added to protein solution (10 μL) using BenchSmart 96 (Rainin) dispenser robot and mixed by pipetting ...
-
No products found
because this supplier's products are not listed.
Marissa Saenz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Following precipitation of plasma proteins with acetonitrile containing 3.5 ng/mL buprenorphine-d4 (Cerilliant, Round Rock, TX, USA) as an internal standard ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Hanako Ono, et al.,
bioRxiv - Genomics 2019
Quote:
Cultured mouse organoids derived from a single cell were harvested and treated with Accumax (Innovative Cell Technologies, AM105) to generate a single-cell suspension ...
-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Annemarie Lang, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a mouse double swing (Datesand Group, Bredbury, United Kingdom) and a Shepherd Shack (Shepherd Specialty Papers, Milford, NJ) where the entrance area was enlarged to avoid injuries due to the external fixator (57) ...
-
No products found
because this supplier's products are not listed.
Rachel J. Harding, et al.,
bioRxiv - Biochemistry 2019
Quote:
... HTT protein was eluted with 1 cell paste volume of buffer supplemented with 250 μg/mL 3xFLAG peptide (Chempep) run twice over the anti-FLAG resin ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Dyah W. Karjosukarso, et al.,
bioRxiv - Systems Biology 2023
Quote:
... pH 7.4), followed by secondary antibody anti-mouse IRDye 800 (1:4000, LiCor Biosciences) and DR (1:4000, Biostatus) for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Paulus G.M. Jochems, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Protein content in the digests as assessed in triplicate on a Flash EA 1112 GC (Interscience BV, Breda, The Netherlands) according the Dumas method (45) ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Haugh, et al.,
bioRxiv - Microbiology 2020
Quote:
... or permeabilized with PBS containing 0.2% Triton X-100 (for stains of intracellular proteins) and treated with Fc receptor blocker (Innovex Biosciences), Richmond ...
-
No products found
because this supplier's products are not listed.
Ashok Narasimhan, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Myocardium proteins were extracted from cryo-fractured tissue using an automated tissue pulverizer (cyroPREP Tissue Disruption System, Covaris model CP02) prior to the addition of urea lysis buffer and sonication.
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Mengjie Li, et al.,
bioRxiv - Microbiology 2024
Quote:
Total RNA was extracted from mouse lung tissue using an RNA extraction kit according to the manufacturer’s instructions (BioMiGA, China). All materials required for the experiment were treated with DPEC water to remove RNA enzyme (BioMiGA ...
-
No products found
because this supplier's products are not listed.
Sylvie Labrouche-Colomer, et al.,
bioRxiv - Genetics 2020
Quote:
... The concentration of total and free PS antigen were determined by an enzyme-linked immunosorbent assay (Asserachrom total or free protein S; Diagnostica Stago). In normal conditions ...
-
MCAT (180 aa) recombinant protein +GST-tag at NT.
Cat# HRP1007,
Inquiry
Ask
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pseudovirus (an HIV-based luciferase expressing lentivirus pseudotyped with SARS-CoV-2 full length S protein) was obtained from Creative Biogene. One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Emily D Hartjes, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 0.2mg/mL microsomal protein and reaction buffer (50mM potassium phosphate with 2mM MgCl2 pH 7.4) was incubated with 1µL testosterone (Steraloids Inc., Newport, RI) at concentrations of 12.5 ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Lu Lu, et al.,
bioRxiv - Biochemistry 2023
Quote:
Quantitative detection of milk protein in bovine milk-derived exosomes was performed according to the manufacturer’s instructions (RIDASCREEN FAST Milk kit, R-Biopharm, Germany). Quantitative detection of IgM/IgG in exosomes was performed according to the manufacturer’s instructions (IgM/IgG cow ELISA kit ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Yuka Takemon, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Mice were fully genotyped for 78,000 SNPs using the GeneSeek Mega Mouse Universal Genotyping Array (MegaMUGA) (Neogen Genomics, Lincon, NE, USA) [43] ...
-
No products found
because this supplier's products are not listed.
Jessica Spring, et al.,
bioRxiv - Microbiology 2022
Quote:
... single cell suspensions (with red blood cells) from RL-MuLV infected mouse spleens were serially diluted in Clicks medium (Irvine scientific) and were subjected to the infectious center assay (Rowe et al. ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
The α and β chains of the MEL5 TCR were engineered to contain mouse constant domains [20] and cloned into a single pSF-Lenti-EF1α lentiviral vector (Oxford Genetics) separated by an internal ribosomal entry site (IRES ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Malene E Lindholm, et al.,
bioRxiv - Genetics 2020
Quote:
Neonatal rat ventricular myocytes (NRVMs) were isolated from newly born rats using the neonatal rat/mouse cardiomyocyte isolation protocol from Cellutron (nc-6031) according to the specifications from the manufacturer ...
-
No products found
because this supplier's products are not listed.
Maximilian Seurig, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and 13 μL of 27mM mal-PEG (Methoxypolyethylene glycol maleimide, typically 5kDa from Sigma, or 2 kDa from Nanocs, NY, for protein Q1MPU8). The samples were incubated with continuous mixing at 30°C for 1 h and the reaction was quenched by mixing with 17.5 μL 5x Sample Buffer (120 mM Tris–HCl pH 6.8 ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology, LVR-1046) to create the final lentiviral plasmid pLV-CMV-GCaMP6s-P2A-TACR1-T2A-hG15-PGK-Hyg ...
-
No products found
because this supplier's products are not listed.
Dmytro Morderer, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Immunostained sections were washed 3×5 minutes with Wash Buffer followed by HRP-mediated protein proximity labelling in Labelling Buffer (1xTBS, 5 uM biotin-ss-tyramide (Iris Biotech, LS-3570), 0.03% H2O2 ...
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Hanah M. Georges, et al.,
bioRxiv - Immunology 2023
Quote:
Human and mouse FMs were homogenized using a beadbug microtube homogenizer with microtubes pre-filled with high impact zirconium beads (Benchmark Scientific; Sayreville, NJ) as previously described (6) ...
-
No products found
because this supplier's products are not listed.
Stephan Brouwer, et al.,
bioRxiv - Microbiology 2020
Quote:
... The primary antibodies used for the detection of SpeC and SSA protein in GAS culture supernatants were rabbit antibody to SpeC (PCI333, Toxin Technology; 1:1,000 dilution) and affinity-purified rabbit antibody to SSA (produced by Mimotopes ...
-
No products found
because this supplier's products are not listed.
Wararat Chiangjong, et al.,
bioRxiv - Bioengineering 2023
Quote:
... EVs were then isolated from the soluble protein contaminants by qEV size exclusion chromatography (qEVoriginal/35 nm Legacy, IZON Science Ltd., Christchurch, New Zealand) as previously described [33,34] ...
-
No products found
because this supplier's products are not listed.
Anna Tasegian, et al.,
bioRxiv - Physiology 2024
Quote:
... a 50% conditioned media (1:1 dilution in advanced D-MEM/F12 base media) was generated from genetically modified L-WRN mouse fibroblast cell line (ATCC, #CLR-3276™, ATCC, LGC Standards, Middlesex, UK) cultured in advanced D-MEM/F12 (Thermofisher ...
-
CDH18 is expressed specifically in the central nervous system and is putatively involved in...
Cat# 5090-0.1MG,
0.1 mg, USD $235.0
Ask
Caroline Gélabert, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... were seeded in 96-well plates coated with the extracelular matrix (ECM) proteins collagen I (1.7 mg/ml, PureCol, Advanced BioMatrix, Inc., San Diego, CA, USA) or without coating for 60 min ...
-
No products found
because this supplier's products are not listed.
Erica L. Stone, et al.,
bioRxiv - Immunology 2021
Quote:
... blocks were cut in 5 μm sections that were placed on glass slides for anti-IgG (UltraPolymer Goat anti-Mouse heavy and light chain IgG-HRP, Cell IDx, San Diego, CA, USA) or anti-C3 (EPR19394 ...
-
No products found
because this supplier's products are not listed.
Aleksi Isomursu, et al.,
bioRxiv - Biophysics 2020
Quote:
Cells that were collected for protein lysates were cultured on commercial hydrogel-coated 6-well plates (Matrigen, SW6-EC-0.5/SW6-EC-8/SW6-EC-50). These gels were similarly coated with 10 μg/ml of fibronectin before use.
-
No products found
because this supplier's products are not listed.
Lauren G. Mascibroda, et al.,
bioRxiv - Biochemistry 2020
Quote:
... pTEF or pTEFdual plasmids were included to express proteins in trans and were transformed with pOBD plasmids and selected on media lacking tryptophan and uracil (Sunrise Science Products, San Diego CA, 1316-030). Yeast strains were then mated and subsequently selected on medium lacking tryptophan ...
-
No citation found on bioRxiv
-
Catalog #: P2010011 (25 ug)
- THIS PRODUCT HAS BEEN DISCONTINUED -
Erythropoietin...
Cat# P2010011,
USD $495.0
No citation found on bioRxiv
-
EPO Fragment MS Protein Standard, is a protein fragment containing a 50-150 amino acid sequence...
Cat# CPILF22501,
inquiry, contact supplier for pricing
No citation found on bioRxiv
-
Custom
Cat# PE-0512,
, Inquire for price
No citation found on bioRxiv