-
No products found
because this supplier's products are not listed.
Madeline J. Price, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 mg/ml soluble CD40L (Fitzgerald), 10 ng/ml IL-21 ...
-
No products found
because this supplier's products are not listed.
Álvaro Inglés-Prieto, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cells were treated with recombinant human GDNF (Shenandoah Biotechnology) and human GFRα1 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Matthew R. Kent, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... A water-soluble cumate solution (QM150A-1, System Biosciences) was used to induce PAX3::FOXO1-T2A-mCherry ...
-
No products found
because this supplier's products are not listed.
Liangxi Wang, et al.,
bioRxiv - Genomics 2022
Quote:
... 10 ng/ml recombinant human TNFα (Cell Applications, cat# RP1111-50) was added for 3 hours ...
-
No products found
because this supplier's products are not listed.
Steven A. Cincotta, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... we utilized fluorophore-conjugated forms of the lectin wheat germ agglutinin (WGA) (Biotium, 29022- 1, 29062-1, 29025-1) to outline all cellular membranes ...
-
No products found
because this supplier's products are not listed.
Sounak Chowdhury, et al.,
bioRxiv - Microbiology 2021
Quote:
... Recombinant human IgA-Fc domain (catalog number PR00105) was purchased from Absolute Antibody, UK.
-
No products found
because this supplier's products are not listed.
Sang-Ho Kang, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The DNA/Polymerase Binding Kit P6 (PacBio) was used for DNA synthesis after the sequencing primer annealed to the SMRTbell template ...
-
No products found
because this supplier's products are not listed.
Tiffany Russell, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 50 U/mL penicillin/streptomycin and 1% human serum (BioIVT). HSV1 strain Sc16 was used routinely ...
-
No products found
because this supplier's products are not listed.
Michael B. Doud, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
No products found
because this supplier's products are not listed.
Shiri Levy, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 25 ng/ml human recombinant FGF4 (Reliatech), 2 ng/ml human recombinant TGF-ß1 (PeproTech) ...
-
No products found
because this supplier's products are not listed.
Wenxiang Xue, et al.,
bioRxiv - Microbiology 2024
Quote:
... Recombinant Human TNF-α (P00029) was purchased from Solarbio, China ...
-
No products found
because this supplier's products are not listed.
Kathryn L. Wofford, et al.,
bioRxiv - Bioengineering 2019
Quote:
... either human recombinant myelin basic protein (Alfa Aesar, cat. #AAJ66051LB0) fluorescently labeled with Vybrant DiD (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Michael J Abrams, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and 0.1 mg/mL insulin (human recombinant, MP Biomedicals 0219390080). To introduce the molecular factors ...
-
This antibody is a recombinant mouse monoclonal antibody which specifically reacts with human...
Cat# MOB-0040MZ,
Inquiry
Ask
Haizhang Chen, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant CD20 was obtained as a peptide (aa141-188) containing the binding region of rituximab (Creative Biolabs). FcγR-specific mAbs were obtained from Stem Cell technologies (CD16 ...
-
No products found
because this supplier's products are not listed.
Emilio Boada-Romero, et al.,
bioRxiv - Cell Biology 2023
Quote:
Lipid binding capacity of recombinant proteins or anti-PS antibody were analyzed using lipid arrays (Echelon Biosciences Inc ...
-
No products found
because this supplier's products are not listed.
Frédéric Frottin, et al.,
bioRxiv - Biochemistry 2020
Quote:
... transfected cells were treated with 20 ng/ml recombinant human TNFα (Jena Biosciences) for 30 min ...
-
No products found
because this supplier's products are not listed.
Tiago Carvalheiro, et al.,
bioRxiv - Immunology 2023
Quote:
... Soluble (s)LAIR-1 (as described previously34) and LAIR-2 (LifeSpan BioSciences) were also measured by ELISA in the serum of HC and SSc patients.
-
No products found
because this supplier's products are not listed.
Brigitta M. Laksono, et al.,
bioRxiv - Microbiology 2022
Quote:
... or fluorescein-labeled Sambucus nigra lectin (SNA) (5 μg/ml; EY Laboratories; BA-6802-1), respectively ...
-
No products found
because this supplier's products are not listed.
Pasquale Valenzisi, et al.,
bioRxiv - Cell Biology 2024
Quote:
... recombinant anti-S9.6 (rabbit-monoclonal, Kerafast; 1:200), anti-RAD51 (rabbit-polyclonal ...
-
No products found
because this supplier's products are not listed.
Yu-Le Wu, et al.,
bioRxiv - Biophysics 2021
Quote:
... Binding of primary antibody (Elys (catalog no. HPA031658, Atlas Antibodies, 1:50), Nup133 (catalog no ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Yu Zhang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and rabbit-anti-human S100 (1:100, CP021A, Biocare) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Muhammad Rizwan, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Recombinant protein G (Cedarlane Labs Inc). All solvents were purchased from Caledon ...
-
No products found
because this supplier's products are not listed.
Irina Buckle, et al.,
bioRxiv - Immunology 2022
Quote:
... and 50ng/ml recombinant human IL-18 (MBL International) were added to the IL-15 cultures for the last 12 hrs (overnight stimulation).
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... The soluble recombinant E protein was recovered by 6-HIS affinity chromatography on Ni-NTA agarose (G-Biosciences) and purified by size exclusion chromatography on a Superdex S200 Increase column (Cytiva).
-
No products found
because this supplier's products are not listed.
Laura Pezzè, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Recombinant human IFN-β and IFN-γ (Peprotech, Tebu-Bio, Milan, Italy) were used at different concentrations and for different time points based on the experiment ...
-
No products found
because this supplier's products are not listed.
Joёl Lemière, et al.,
bioRxiv - Biophysics 2021
Quote:
Cells in lectin-treated μ-Slide VI 0.4 channel slides (#80606, Ibidi) were imaged in fields of 250×250 pixels or smaller using highly inclined laser beam illumination at 100 Hz for 10 s ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... ELISAs specific for the lectin pathway contained single 1 μM concentrations of FbpC-C or BBK32-C incubated with 2% C1q-depleted NHS (Complement Technologies). Serum incubations were performed in complement ELISA buffer (10 mM HEPES pH 7.3 ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Charlie J. Childs, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human Fibrinogen 1 Plasminogen Depleted (Enzyme Research Lab Cat#FIB-1), and X-Vivo 20 (Lonza Cat#190995) ...
-
No products found
because this supplier's products are not listed.
Norie Sugitani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... supplemented with 1 µM human gp100 (25-33) (Eurogentec) and 50 U/mL IL-2 (PeproTech ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Shanshan Ding, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The soluble sugar and tannin contents were determined with a microplate reader (Infinite F50, Tecan).
-
No products found
because this supplier's products are not listed.
Takeshi Sakuno, et al.,
bioRxiv - Cell Biology 2022
Quote:
... without nitrogen were sonicated briefly and immobilized on a coverslip coated with lectin in a 35 mm glass-bottomed culture dish (MatTek) and observed at 26°C in liquid EMM2 (1% glucose ...
-
No products found
because this supplier's products are not listed.
GC Bibek, et al.,
bioRxiv - Microbiology 2023
Quote:
... The reaction produced a soluble product measured spectrophotometrically at 565 nm with a CYTATION 5 image reader (BioTeK). The known indole concentrations from 0 to 100 µM were tested in triplicate ...
-
No products found
because this supplier's products are not listed.
Kevin P. Foley, et al.,
bioRxiv - Physiology 2020
Quote:
... Human insulin (Mercodia) and human C-peptide (Millipore ...
-
No products found
because this supplier's products are not listed.
Pingdewinde N. Sam, et al.,
bioRxiv - Cell Biology 2020
Quote:
... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
No products found
because this supplier's products are not listed.
Tamar Cranford Smith, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and expression of His3-SUMO-AscA (or His3-SUMO-AscAΔMBD) was induced using 1 mM isopropyl-thio-galactoside (IPTG; Bioline) overnight at 18°C ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ravichandra Vemuri, et al.,
bioRxiv - Pathology 2021
Quote:
... lipopolysaccharide-binding protein (LBP)-1 (Hycult Biotech Inc., Plymouth Meeting, PA) and soluble (s ...
-
No products found
because this supplier's products are not listed.
Yifeng Bu, et al.,
bioRxiv - Physiology 2022
Quote:
... Water soluble tape (3M, Inc. – Saint Paul, MN) was then used to transfer print the device from the silicon wafer to a flexible silicone substrate made on a 5” petri dish that was spun coated at 3000 rpm with Ecoflex (Smooth On ...
-
No products found
because this supplier's products are not listed.
Yuya Maruyama, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... GTP binding assay was performed using a GTP Gi Binding Assay Kit (Cisbio) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Gareth T. Powell, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... was used to identify potential binding partners for multimerised human CACHD1 ectodomain (prepared as above) and was performed by Charles River Discovery Research Services UK Limited (formerly Retrogenix Limited ...
-
No products found
because this supplier's products are not listed.
Peng Dong, et al.,
bioRxiv - Genomics 2022
Quote:
... Mouse embryonic stem cells were plated on Human recombinant laminin 511-coated coverslips (Electron Microscopy Sciences, Cat. 72196-25). Cells were then fixed using 4% formaldehyde (Thermo Fisher Scientific ...
-
Type I collagen supplied as a 6mg/ml liquid preparation in 75 mM sodiuim citrate, pH 3.6 - 4.0,...
Cat# LS001663,
Bulk, Inquire
Ask
Meiling Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Recombinant HIV (Worthington) and HiScript III (Vazyme ...
-
No products found
because this supplier's products are not listed.
Drake M. Mellott, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant proteases were obtained from the following vendors: human cathepsin L (Millipore Sigma, Athens Research and Technology, Inc., (Texas A&M) or R&D Systems (UCSD) ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...