-
No products found
because this supplier's products are not listed.
Tyler B. Waltz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Depletion of p11 from the media was confirmed using Rat S100 Calcium Binding Protein A10 (S100A10) ELISA Kit (Biomatik, Cat# EKN48271-96T) as per the attached instructions.
-
No products found
because this supplier's products are not listed.
Bhairavi Tolani, et al.,
bioRxiv - Cancer Biology 2020
Quote:
The plasma membrane protein extraction kit (BioVision) was used to separate the plasma membrane fraction from other cellular membranes according to the manufacturer’s recommended protocol ...
-
No products found
because this supplier's products are not listed.
Zhengyang Lei, et al.,
bioRxiv - Immunology 2023
Quote:
... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
No products found
because this supplier's products are not listed.
Markus Holzner, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Vmp1: the gRNA (gagacgcatagcaatgagta) was cloned into a px330 vector (Addgene, #158973). Per 3cm well ...
-
No products found
because this supplier's products are not listed.
Francesca Querques, et al.,
bioRxiv - Cell Biology 2021
Quote:
... proteins were transferred to BiotraceNT membrane (VWR) and incubated with primary antibodies ...
-
No products found
because this supplier's products are not listed.
Niels Pietsch, et al.,
bioRxiv - Physiology 2024
Quote:
... anti-rat (1:10,000 Dianova) or anti-rabbit (1:6,000 ...
-
No products found
because this supplier's products are not listed.
Alexandra Turfe, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Two rats were excluded from all analyses—one rat (n=1 Male VEH Charles River) died on the second day of injections in the experiment ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...
-
No products found
because this supplier's products are not listed.
Tyler B. Waltz, et al.,
bioRxiv - Neuroscience 2023
Quote:
Recombinant rat protein p11 (S100A10 Recombinant Protein, Aviva Systems Biology, OPCD06771) was dissolved in distilled water to obtain a final concentration of 100ug/mL and stored at -80C for less than one month ...
-
No products found
because this supplier's products are not listed.
Salek Ahmed Sajib, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and vacuole V-ATPase (Agrisera, AS07 213). The blots were developed with Clarity Western ECL substrate (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Vedita Anand Singh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
High protein binding 96-well ELISA plate (Greiner bio-one, USA) was coated with 1 µg/well of RBD protein (home-made ...
-
No products found
because this supplier's products are not listed.
Belinda J Hernandez, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... guinea pig anti-lysosomal-associated membrane protein 3 (LAMP3, 1:500, Synaptic Systems, 391005), rat anti-advanced glycosylation end product-specific receptor (RAGE ...
-
C-Reactive Protein ( CRP ) ELISA / Assay Kit
Cat# K069-H1,
1.0 ea, USD $390.0
Ask
Sarah E. Westrick, Ryan T. Paitz, Eva K. Fischer,
bioRxiv - Physiology 2023
Quote:
We used DetectX® ELISA kits from Arbor Assays™ (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
David A. Garcia, et al.,
bioRxiv - Biophysics 2020
Quote:
... The construct expresses rat GR fused with HaloTag protein (Promega, Madison, WI, USA) in the C-terminal domain under the CMVd1 promoter ...
-
No products found
because this supplier's products are not listed.
Apurva S. Chitre, et al.,
bioRxiv - Genetics 2020
Quote:
... rats in NY were fed Teklad 18% Protein Rodent Diet (Envigo, Madison, Wisconsin), and rats in MI were fed Picolab Laboratory Rodent Diet Irradiated (LabDiet ...
-
No products found
because this supplier's products are not listed.
Tai Chaiamarit, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Goat anti-rat Atto594 (1:200; Rockland Immuno); Alexa Fluor 647 Phalloidin in methanol (1:40 ...
-
No products found
because this supplier's products are not listed.
Alexandra Maslennikova, et al.,
bioRxiv - Microbiology 2021
Quote:
The levels of HIV-1 core protein Gag in cell supernatants were quantified using HIV-1 p24 ELISA Kit (Zeptometrix, Bufalo NY, USA) in accordance to the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Alia Hasan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Serum PTH or PTH secreted to growth medium in organ cultures was measured using rat or mouse 1–84 Intact PTH ELISA kit (Quidel, Athens, Ohio).
-
No products found
because this supplier's products are not listed.
Deepa Ramasamy, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Guizhen Fan, et al.,
bioRxiv - Biophysics 2022
Quote:
... rat cerebellar membranes were solubilized in 2 mM Lauryl Maltose Neopentyl Glycol (LMNG, Anatrace) and 0.1% (w/v ...
-
No products found
because this supplier's products are not listed.
Soumik Barman, et al.,
bioRxiv - Immunology 2022
Quote:
... IFNβ was measured with a bioluminescent ELISA kit (LumiKine, Invivogen). For experiments involving blocking antibodies (Abs) ...
-
No products found
because this supplier's products are not listed.
Carlos Patiño Descovich, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... anti-rat Cy5 (Jackson Labs, 1:400), anti-guinea pig AlexaFluor 488 (Life Technologies ...
-
No products found
because this supplier's products are not listed.
C Ferreras, et al.,
bioRxiv - Immunology 2020
Quote:
... and the complete sequence of the nucleocapsid phosphoprotein N and the membrane glycoprotein M (GenBank MN908947.3, Protein QHD43416.1, Protein QHD43423.2, Protein QHD43419.1) (Miltenyi Biotec, Germany). After 5 hours of stimulation ...
-
No products found
because this supplier's products are not listed.
Lauren G. Chukrallah, et al.,
bioRxiv - Genetics 2022
Quote:
... membranes were stained with SYPRO-Ruby Protein Gel Stain (Lonza Rockland) to confirm equal loading ...
-
No products found
because this supplier's products are not listed.
Tahir Idris, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The proteins were then transferred onto Porablot NCP nitrocellulose membrane (Macherey-Nagel) and blocked for 1 hour at RT in 3% BSA (Applichem ...
-
No products found
because this supplier's products are not listed.
Sajina Shakya, et al.,
bioRxiv - Physiology 2020
Quote:
... rat monoclonal TNFα (1 μg/ml; BioXCell, West Lebanon, NH); or rabbit anti-mouse Actin (1:1000 ...
-
No products found
because this supplier's products are not listed.
Karine Massé, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Native membrane proteins were extracted from transfected cells using the ProteoExtract® Native Membrane Protein Extraction Kit (Calbiochem). Proteins from whole cells and from the membrane and soluble fractions were separated on a 12% SDS-PAGE protein gel ...
-
No products found
because this supplier's products are not listed.
Yu Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the dCas9 protein was quantified using the CRISPR/Cas9 assay ELISA kit (Epigentek).
-
No products found
because this supplier's products are not listed.
Seyed. M. Ghiasi, et al.,
bioRxiv - Cell Biology 2023
Quote:
Insulin concentration (ng/ml or pM) was measured using rat insulin ultra-sensitive ELISA kit (Cat#62IN2PEG, Cisbio, Cambridge, England) or human insulin ELISA kit (Cat#90095 ...
-
No products found
because this supplier's products are not listed.
Ann Marie Centner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
No products found
because this supplier's products are not listed.
Tomoki Togashi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... hPC antigen (hPC:Ag) was measured using the Human Protein C AssayMaxTM ELISA Kit (Assaypro, St. Charles, MO) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
J. Sebastian Jara, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The amount of p24 capsid protein was determined by the HIV-1 p24 ELISA antigen assay (Beckman Coulter, Fullerton, CA). Virus from different productions averaged 175 ng/µl of p24 antigen.
-
No products found
because this supplier's products are not listed.
Maud Dupont, et al.,
bioRxiv - Microbiology 2023
Quote:
... Immunoblot membranes were incubated with primary antibodies directed against the viral proteins HA (Genetex GTX127294, 1:1,500), PB2 (Genetex GTX125925 ...
-
No products found
because this supplier's products are not listed.
Jelena Osmanovic Barilar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... ELISA kit was purchased from Tecan IBL International (Hamburg ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Na Fei, et al.,
bioRxiv - Physiology 2023
Quote:
... Serum LBP level was measured by a Mouse Lipopolysaccharide Binding Protein ELISA Kit (HyCult Biotechnology, Uden, The Netherlands). All assays were performed according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Annett Boeddrich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... diluted 1:18 in standard diluent delivered with the Arl8b ELISA kit (CUSABIO, CSB-EL002100HU). All steps were performed according to supplier protocols ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
João Pedro Fonseca, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Measurements for cAMP ELISA and BCA Protein Assay kits were performed in a FlexStation 3 Multi-Mode Microplate Reader (Molecular Devices). The cAMP dose response to light was fit to a hyperbolic equation and confidence intervals were extracted by bootstrapping in a custom Python Script available on GitHub (https://qithub.com/jpfon/cAMP).
-
No products found
because this supplier's products are not listed.
Maïté Courel, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ...
-
Rat Vacuole Membrane Protein 1 (VMP1) ELISA Kit is an ELISA Kit for the in vitro quantitative...
Cat# abx556221-96T,
96 tests USD $797.5
Ask
Mohadeseh Hasanpourghadi, et al.,
bioRxiv - Immunology 2022
Quote:
Sera were tested for antibodies to the N protein by an ELISA on plates coated with 1 µg of a purified N protein (Abbexa, abx163973) using the same procedures as for antibodies to the S protein ...
-
No products found
because this supplier's products are not listed.
Joanna L. Fiddler, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Membranes were imaged using FluorChem E (Protein Simple), and densitometry was performed with ImageJ (version 1.53a ...
-
No products found
because this supplier's products are not listed.
Jesse M. Hall, et al.,
bioRxiv - Microbiology 2021
Quote:
... ELISA plates were washed as described above and 100μl of secondary goat anti-rat IgG (SouthernBiotech Cat. 3030-04), goat anti-rat IgM (SouhternBiotech Cat ...
-
No products found
because this supplier's products are not listed.
Andrew H. Pham, et al.,
bioRxiv - Microbiology 2021
Quote:
... IFNα was quantified using the pan-IFNα ELISA kit (Stem Cell Technologies). IFNβ was quantified using human IFN-beta Quantikine ELISA kit (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Qi Ding, et al.,
bioRxiv - Neuroscience 2019
Quote:
... PI3 kinase activity was measured using PI3 kinase activity ELISA kit from Echelon Biosciences according to the manufacture’s protocol ...
-
No products found
because this supplier's products are not listed.
Adam J. Rocker, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA color development was monitored with an ELISA plate reader (BioTek Synergy 2 Multi-Mode Reader) at 405 nm with wavelength correction set at 650 nm ...
-
No products found
because this supplier's products are not listed.
Qiuli Shi, et al.,
bioRxiv - Microbiology 2021
Quote:
Proteins were labeled using the Monolith NT Protein Labeling Kit RED (NanoTemper Technologies) according to the manufacturer’s protocol and using a buffer consisting of 20 mM HEPES ...
-
With the RapidClean protein removal kit, completely remove protein from aqueous solutions of...
Cat# K-01001-010,
10 reactions, USD $145.00/ea
Ask
Azita Gorji, et al.,
bioRxiv - Cell Biology 2019
Quote:
Separated proteins were transferred to PVDF membrane in 1x FLASHBlot Transfer Buffer (Advansta) for 80 minutes at 90V at 4°C and blocked with 3% BSA for 1h at room temperature ...