-
No products found
because this supplier's products are not listed.
William R. Arnold, et al.,
bioRxiv - Biochemistry 2023
Quote:
Nanodisc reconstitution of purified minimal TRPV1 with soybean polar lipids or a defined lipid composition (purchased from Avanti Polar Lipids), was performed following the protocol described previously5 ...
-
No products found
because this supplier's products are not listed.
Molly E. Mitchell, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Dual-IF with nociceptor markers was performed by incubating 7G1-1 with either rabbit anti-TRPV1 or rabbit anti-CGRP (1:500; Immunostar 24112). For triple IF ...
-
No products found
because this supplier's products are not listed.
Yingying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The shRNA was injected using a nanoinjector (Sutter Instrument, Novato, CA). After all the shRNA was injected ...
-
No products found
because this supplier's products are not listed.
VA Brentville, et al.,
bioRxiv - Immunology 2023
Quote:
Murine and rat ELISpot kits (Mabtech) were used with 5×105 splenocytes/well in RPMI with L-glutamine ...
-
No products found
because this supplier's products are not listed.
Yoko Miura, et al.,
bioRxiv - Pathology 2021
Quote:
... rat anti-B220/CD45R (Aviva Systems Biology), rabbit anti-collagen I (Novus Biologicals) ...
-
No products found
because this supplier's products are not listed.
Yuehua He, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and (Rat, Bioss DS-0293G,1:5000), the immunoreactive band was visualized using an ECL detection kit (Beyotime Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Hsiu-Chuan Lin, et al.,
bioRxiv - Bioengineering 2023
Quote:
... co-cultured with rat cortical astrocytes (Genlantis) on PLO/LMN-coated 8-well or 96-well polymer coverslips (µ-Slide ibiTreat ...
-
No products found
because this supplier's products are not listed.
Jayanth S. Shankara Narayanan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Rat HRP Polymer (Cell IDX, 2AH-100) or anti-Rabbit HRP Polymer (Cell IDX ...
-
No products found
because this supplier's products are not listed.
Savroop Bhamra, et al.,
bioRxiv - Molecular Biology 2022
Quote:
pRetrosuper shRNA and pLNCX2 constructs were packaged as ecotropic retroviruses in Phoenix ecotropic cells (ATCC, LGC Standards, Middlesex, UK) and used to stably transduce PK1 and CAD5 cells and derivatives thereof ...
-
No products found
because this supplier's products are not listed.
Wesley W. Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Plasmid DNA was purified using Zyppy Plasmid Miniprep Kit (Genesee Scientific) and sequenced using primers as followed ...
-
Cat# HY-P1747,
inquire
Ask
Shuangshuo Jia, et al.,
bioRxiv - Cell Biology 2023
Quote:
... An in vitro OA model was induced by treating rat primary chondrocytes with recombinant rat Interleukin-1β (IL-1β) (10 ng/mL) (MedChemExpress, Shanghai, China) for 24 h ...
-
No products found
because this supplier's products are not listed.
Katherine L. Leiby, et al.,
bioRxiv - Bioengineering 2022
Quote:
Primary rat lung microvascular endothelial cells (RLMVEC, VEC Technologies) were cultured on fibronectin (1 μg/cm2 ...
-
No products found
because this supplier's products are not listed.
Katharina Braunger, et al.,
bioRxiv - Immunology 2021
Quote:
... rat and guinea pig serum were from Complement Technology.
-
No products found
because this supplier's products are not listed.
Haixia Zhang, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Fresh rat serum (RS) was purchased from Lampire Biological Laboratories (Pipersville ...
-
No products found
because this supplier's products are not listed.
Allison E. Hall, Diana Klompstra, Jeremy Nance,
bioRxiv - Developmental Biology 2023
Quote:
... rat anti-mCherry 1:100 (clone 5F8; Antibodies-online), rat anti-GFP 1:1,000 (Nacalai Tesque) ...
-
No products found
because this supplier's products are not listed.
Mengru Zhuang, et al.,
bioRxiv - Neuroscience 2022
Quote:
GC neurons infected with lentiviral shYthdf2 and control shRNA for 48 hr were treated with actinomycin D (ActD, 5 μg/ml, ApexBio Technology) and collected at indicated time points ...
-
No products found
because this supplier's products are not listed.
Gunsagar S. Gulati, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Cells were Fc-blocked with of rat IgG (LifeSpan BioSciences) and stained with 5 μg/ml of rat anti-mouse antibodies (catalog no. ...
-
No products found
because this supplier's products are not listed.
Ok-Hee Kim, et al.,
bioRxiv - Physiology 2019
Quote:
... rat intact and C-terminal FGF23 (Elabscience, Houston, TX, USA), and human intact FGF23 (Elabscience ...
-
No products found
because this supplier's products are not listed.
Yasuhiro Fujiwara, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rat Isotype IgG2a-APC (clone LTF2) (TONBO Bioscience, #20-4031) were added to single cell suspension with 1:100 dilution ...
-
No products found
because this supplier's products are not listed.
Soham Dibyachintan, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... the plasmid DNA was extracted from bacteria using a plasmid extraction kit (FroggaBio) to validate the plasmid single mutant libraries ...
-
No products found
because this supplier's products are not listed.
Vojtech Zila, et al.,
bioRxiv - Microbiology 2020
Quote:
... SupT1-R5 cells with AAV (expressing CPSF6 shRNA or non-silencing control shRNA) were distributed at 72 h post-transduction into 96-well plates (1 × 105 cells/well; U-bottom; Greiner Bio-One) and infected with wild-type HIV-1 (1 μUnits of RT/cell) ...
-
No products found
because this supplier's products are not listed.
Yuko Ishida, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat anti-mouse F4/80 mAb (clone, BM8; BMA Biomedicals, Switzerland), rabbit anti-human CD3 pAbs ...
-
No products found
because this supplier's products are not listed.
Shogo Soma, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats received 100 nL of Fluoro-Gold (2.5% in H2O, Fluorochrome) and 1,200 nL of mRFP expressing G-deleted rabies viral vector (rHEP5.0-ΔG-mRFP ...
-
No products found
because this supplier's products are not listed.
Farshad Guirakhoo, et al.,
bioRxiv - Immunology 2021
Quote:
... Rat IL-4 T cell ELISpot kit (U-CyTech, Cat. No.: CT081) and Rat IL-2 ELISpot Kit (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Irina Bregy, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Alexa Fluor® 488 goat anti-rat IgG (H+L)(Nanoprobes/FluoroNanogold) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Alice L. B. Pyne, et al.,
bioRxiv - Biophysics 2021
Quote:
Plasmid pBR322 was supplied by Inspiralis Ltd (Norwich ...
-
No products found
because this supplier's products are not listed.
Loredana Leggio, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or rat-anti-CD63 (MBL, D263-3)) in 0.1% BSAc (Electron Microscopy Sciences) for 1 h ...
-
No products found
because this supplier's products are not listed.
Raphaëlle Luisier, et al.,
bioRxiv - Neuroscience 2022
Quote:
Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
No products found
because this supplier's products are not listed.
Hibah O. Awwad, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The manufacturer’s recommendations for the respective rat ELISA kits were followed (Bosterbio, Pleasanton, CA). Duplicate samples were normalized to protein concentration ...
-
No products found
because this supplier's products are not listed.
Adam R. Denton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Brains were sliced on a standard rat brain matrix (Ted Pella, Inc., Redding, CA) at a thickness of 500 μm.
-
No products found
because this supplier's products are not listed.
Ricardo León-Sampedro, et al.,
bioRxiv - Microbiology 2020
Quote:
... The sequences belonging to pOXA-48 plasmid were mapped using the complete sequence of one of the plasmid sequenced by PacBio as reference (from K ...
-
No products found
Jasmine Plummer, et al.,
bioRxiv - Genetics 2020
Quote:
Overexpression of RCCD1 was accomplished using a sequence validated RCCD1 cDNA clone (HsCD00936904) This plasmid along with a control plasmid containing CAGG sequence were purchased from the DNASU repository (Biodesign Institute ...
-
No products found
because this supplier's products are not listed.
Shuhei Murase, et al.,
bioRxiv - Bioengineering 2022
Quote:
Twelve-week-old male WKY rats were scanned in a 7.0-Tesla MRI system (Biospec 70/30-USR ...
-
No products found
because this supplier's products are not listed.
Sangsoon Park, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rat cardiac cells were cultured and treated with chemicals in 6-well plates (83.3920, Sarstedt) covered with HoloLids (PHI ...
-
No products found
because this supplier's products are not listed.
Eugenia A. Panova, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The resulting plasmid was then digested with SmaI (Sibenzyme) and assembled with PCR product containing mRNA template elements (T7-promoter ...
-
No products found
because this supplier's products are not listed.
Xin Zhao, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the rats were anesthetized and perfused with Microfil (Microfil MV-122; Flow Tech, Carver, MA, USA). The method was as followsed ...
-
No products found
because this supplier's products are not listed.
Benoît P. Nicolet, et al.,
bioRxiv - Immunology 2019
Quote:
... were pre-coated overnight at 4°C with 4μg/mL rat α-mouse IgG2a (MW1483, Sanquin) in PBS ...
-
No products found
because this supplier's products are not listed.
Masachika Ikegami, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Plasmids were fragmented by an E220 Focused-ultrasonicator (Covaris, Inc.) to an average size of 300 bp ...
-
No products found
because this supplier's products are not listed.
Yvan M. Vachez, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were individually placed in a 30cm x 20cm behavioral arena (Lab Products Rat One Cage 2100™) and given 60 min/day to consume a highly palatable liquid (Nesquik® ...
-
No products found
because this supplier's products are not listed.
Jessica J. Rea, et al.,
bioRxiv - Neuroscience 2024
Quote:
Rats were individually housed in BioDAQ Food and Water intake monitoring system (Research Diets Inc. New Brunswick, NJ) which recorded episodic ad libitum feeding activity of rats in their home cages ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... coli from a pET16b plasmid in SuperBroth medium (Teknova, Hollister, CA) and purified by ammonium sulfate fractionation ...
-
No products found
because this supplier's products are not listed.
Bryan Frey, et al.,
bioRxiv - Biochemistry 2020
Quote:
... BacMam viral plasmids & production was performed by Oxford Expression Technologies (OET) using the template DNA from Addgene plasmids #89470 & #89471 ...
-
No products found
because this supplier's products are not listed.
Geronimo Velazquez-Hernandez, et al.,
bioRxiv - Neuroscience 2020
Quote:
Rats were anesthetized with isoflurane inhalant gas and implanted with 23-gauge stainless steel guide cannulas (A-M Systems) targeting the lateral region of the habenula (−3.8 mm ...
-
No products found
because this supplier's products are not listed.
Anne F. Cayron, et al.,
bioRxiv - Pathology 2024
Quote:
... rat aortic arches and kidneys were scanned at 10X magnification using the Axio Scan.Z1 automated slide scanner (Carl Zeiss) and images were processed by a blinded observer using the Zen 2 software (Version 3.4.91 ...
-
No products found
because this supplier's products are not listed.
Timothy P. Allen, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... These plasmids were constructed by isothermal assembly of G-Blocks (IDT DNA) or PCR fragments ...
-
No products found
because this supplier's products are not listed.
Kevin Boyé, et al.,
bioRxiv - Cell Biology 2021
Quote:
Binding of anti-Unc5B antibodies to Human or Rat Unc5B was performed using a Biacore™ 8K (Proteogenix, Schiltigheim, France). Human or Rat Unc5B-ECD-Fc (R&D Systems ...
-
No products found
Yusuke Nasu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Experiments were performed with cortical/hippocampal primary cultures from the E21 (after C-section of the pregnant rat) plated in glass-bottom 24-well plates (Cellvis) where 0.5 × 106 cells were used for three wells ...
-
No products found
because this supplier's products are not listed.
S. M. Roche, et al.,
bioRxiv - Microbiology 2021
Quote:
Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
No products found
because this supplier's products are not listed.
Min Zeng, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The antibiotic used for sensor plasmid selection was kanamycin (50 μg/ml, GoldBio). The inducers used for sensors were n-(3-oxododecanoyl)-L-homoserine lactone (C12-HSL ...
-
No products found
because this supplier's products are not listed.
Hongming Fan, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The two-photon microscope used for imaging rat samples was a commercial multiphoton laser scanning microscope (FV1200 inverted, Olympus Corporation, Tokyo, Japan) equipped with an ultrafast Ti:Sapphire laser (MaiTai Deepsee ...